ID: 1169416807

View in Genome Browser
Species Human (GRCh38)
Location 20:5424160-5424182
Sequence TACTCACAGGTTCCAGGGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169416801_1169416807 0 Left 1169416801 20:5424137-5424159 CCCTTTTGCCAAGTAAGATAACA No data
Right 1169416807 20:5424160-5424182 TACTCACAGGTTCCAGGGACTGG No data
1169416800_1169416807 26 Left 1169416800 20:5424111-5424133 CCTTAATTTAATGACATTTGCAA No data
Right 1169416807 20:5424160-5424182 TACTCACAGGTTCCAGGGACTGG No data
1169416803_1169416807 -8 Left 1169416803 20:5424145-5424167 CCAAGTAAGATAACATACTCACA No data
Right 1169416807 20:5424160-5424182 TACTCACAGGTTCCAGGGACTGG No data
1169416802_1169416807 -1 Left 1169416802 20:5424138-5424160 CCTTTTGCCAAGTAAGATAACAT No data
Right 1169416807 20:5424160-5424182 TACTCACAGGTTCCAGGGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169416807 Original CRISPR TACTCACAGGTTCCAGGGAC TGG Intergenic
No off target data available for this crispr