ID: 1169422937

View in Genome Browser
Species Human (GRCh38)
Location 20:5474277-5474299
Sequence CCCTCTGCGATTCTGACCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169422937_1169422951 30 Left 1169422937 20:5474277-5474299 CCTGTGGTCAGAATCGCAGAGGG No data
Right 1169422951 20:5474330-5474352 ACCTCACGTGACTGCTGCGTGGG No data
1169422937_1169422946 7 Left 1169422937 20:5474277-5474299 CCTGTGGTCAGAATCGCAGAGGG No data
Right 1169422946 20:5474307-5474329 GGGAGGGCCTTCCCAGAGGATGG 0: 1
1: 1
2: 4
3: 58
4: 475
1169422937_1169422950 29 Left 1169422937 20:5474277-5474299 CCTGTGGTCAGAATCGCAGAGGG No data
Right 1169422950 20:5474329-5474351 GACCTCACGTGACTGCTGCGTGG No data
1169422937_1169422942 -10 Left 1169422937 20:5474277-5474299 CCTGTGGTCAGAATCGCAGAGGG No data
Right 1169422942 20:5474290-5474312 TCGCAGAGGGGCCATCAGGGAGG No data
1169422937_1169422945 3 Left 1169422937 20:5474277-5474299 CCTGTGGTCAGAATCGCAGAGGG No data
Right 1169422945 20:5474303-5474325 ATCAGGGAGGGCCTTCCCAGAGG 0: 1
1: 1
2: 2
3: 26
4: 266
1169422937_1169422943 -9 Left 1169422937 20:5474277-5474299 CCTGTGGTCAGAATCGCAGAGGG No data
Right 1169422943 20:5474291-5474313 CGCAGAGGGGCCATCAGGGAGGG 0: 1
1: 0
2: 3
3: 32
4: 282

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169422937 Original CRISPR CCCTCTGCGATTCTGACCAC AGG (reversed) Intergenic