ID: 1169422942

View in Genome Browser
Species Human (GRCh38)
Location 20:5474290-5474312
Sequence TCGCAGAGGGGCCATCAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169422932_1169422942 17 Left 1169422932 20:5474250-5474272 CCTGGGACTCTGCTGTGCTGCGG No data
Right 1169422942 20:5474290-5474312 TCGCAGAGGGGCCATCAGGGAGG No data
1169422931_1169422942 20 Left 1169422931 20:5474247-5474269 CCACCTGGGACTCTGCTGTGCTG No data
Right 1169422942 20:5474290-5474312 TCGCAGAGGGGCCATCAGGGAGG No data
1169422937_1169422942 -10 Left 1169422937 20:5474277-5474299 CCTGTGGTCAGAATCGCAGAGGG No data
Right 1169422942 20:5474290-5474312 TCGCAGAGGGGCCATCAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169422942 Original CRISPR TCGCAGAGGGGCCATCAGGG AGG Intergenic