ID: 1169422943

View in Genome Browser
Species Human (GRCh38)
Location 20:5474291-5474313
Sequence CGCAGAGGGGCCATCAGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 318
Summary {0: 1, 1: 0, 2: 3, 3: 32, 4: 282}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169422937_1169422943 -9 Left 1169422937 20:5474277-5474299 CCTGTGGTCAGAATCGCAGAGGG No data
Right 1169422943 20:5474291-5474313 CGCAGAGGGGCCATCAGGGAGGG 0: 1
1: 0
2: 3
3: 32
4: 282
1169422931_1169422943 21 Left 1169422931 20:5474247-5474269 CCACCTGGGACTCTGCTGTGCTG No data
Right 1169422943 20:5474291-5474313 CGCAGAGGGGCCATCAGGGAGGG 0: 1
1: 0
2: 3
3: 32
4: 282
1169422932_1169422943 18 Left 1169422932 20:5474250-5474272 CCTGGGACTCTGCTGTGCTGCGG No data
Right 1169422943 20:5474291-5474313 CGCAGAGGGGCCATCAGGGAGGG 0: 1
1: 0
2: 3
3: 32
4: 282

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169422943 Original CRISPR CGCAGAGGGGCCATCAGGGA GGG Intergenic