ID: 1169422944

View in Genome Browser
Species Human (GRCh38)
Location 20:5474301-5474323
Sequence TCTGGGAAGGCCCTCCCTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 302
Summary {0: 1, 1: 1, 2: 2, 3: 28, 4: 270}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169422944_1169422954 19 Left 1169422944 20:5474301-5474323 CCATCAGGGAGGGCCTTCCCAGA 0: 1
1: 1
2: 2
3: 28
4: 270
Right 1169422954 20:5474343-5474365 GCTGCGTGGGCAAGTGGCACTGG No data
1169422944_1169422953 13 Left 1169422944 20:5474301-5474323 CCATCAGGGAGGGCCTTCCCAGA 0: 1
1: 1
2: 2
3: 28
4: 270
Right 1169422953 20:5474337-5474359 GTGACTGCTGCGTGGGCAAGTGG No data
1169422944_1169422951 6 Left 1169422944 20:5474301-5474323 CCATCAGGGAGGGCCTTCCCAGA 0: 1
1: 1
2: 2
3: 28
4: 270
Right 1169422951 20:5474330-5474352 ACCTCACGTGACTGCTGCGTGGG No data
1169422944_1169422950 5 Left 1169422944 20:5474301-5474323 CCATCAGGGAGGGCCTTCCCAGA 0: 1
1: 1
2: 2
3: 28
4: 270
Right 1169422950 20:5474329-5474351 GACCTCACGTGACTGCTGCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169422944 Original CRISPR TCTGGGAAGGCCCTCCCTGA TGG (reversed) Intergenic