ID: 1169422945

View in Genome Browser
Species Human (GRCh38)
Location 20:5474303-5474325
Sequence ATCAGGGAGGGCCTTCCCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 296
Summary {0: 1, 1: 1, 2: 2, 3: 26, 4: 266}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169422932_1169422945 30 Left 1169422932 20:5474250-5474272 CCTGGGACTCTGCTGTGCTGCGG No data
Right 1169422945 20:5474303-5474325 ATCAGGGAGGGCCTTCCCAGAGG 0: 1
1: 1
2: 2
3: 26
4: 266
1169422937_1169422945 3 Left 1169422937 20:5474277-5474299 CCTGTGGTCAGAATCGCAGAGGG No data
Right 1169422945 20:5474303-5474325 ATCAGGGAGGGCCTTCCCAGAGG 0: 1
1: 1
2: 2
3: 26
4: 266

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169422945 Original CRISPR ATCAGGGAGGGCCTTCCCAG AGG Intergenic