ID: 1169422946

View in Genome Browser
Species Human (GRCh38)
Location 20:5474307-5474329
Sequence GGGAGGGCCTTCCCAGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 539
Summary {0: 1, 1: 1, 2: 4, 3: 58, 4: 475}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169422937_1169422946 7 Left 1169422937 20:5474277-5474299 CCTGTGGTCAGAATCGCAGAGGG No data
Right 1169422946 20:5474307-5474329 GGGAGGGCCTTCCCAGAGGATGG 0: 1
1: 1
2: 4
3: 58
4: 475

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169422946 Original CRISPR GGGAGGGCCTTCCCAGAGGA TGG Intergenic