ID: 1169422947

View in Genome Browser
Species Human (GRCh38)
Location 20:5474314-5474336
Sequence GTGAGGTCCATCCTCTGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169422947_1169422950 -8 Left 1169422947 20:5474314-5474336 CCTTCCCAGAGGATGGACCTCAC No data
Right 1169422950 20:5474329-5474351 GACCTCACGTGACTGCTGCGTGG No data
1169422947_1169422951 -7 Left 1169422947 20:5474314-5474336 CCTTCCCAGAGGATGGACCTCAC No data
Right 1169422951 20:5474330-5474352 ACCTCACGTGACTGCTGCGTGGG No data
1169422947_1169422954 6 Left 1169422947 20:5474314-5474336 CCTTCCCAGAGGATGGACCTCAC No data
Right 1169422954 20:5474343-5474365 GCTGCGTGGGCAAGTGGCACTGG No data
1169422947_1169422956 26 Left 1169422947 20:5474314-5474336 CCTTCCCAGAGGATGGACCTCAC No data
Right 1169422956 20:5474363-5474385 TGGCCACTCTGCCTGGAGAGAGG No data
1169422947_1169422953 0 Left 1169422947 20:5474314-5474336 CCTTCCCAGAGGATGGACCTCAC No data
Right 1169422953 20:5474337-5474359 GTGACTGCTGCGTGGGCAAGTGG No data
1169422947_1169422955 19 Left 1169422947 20:5474314-5474336 CCTTCCCAGAGGATGGACCTCAC No data
Right 1169422955 20:5474356-5474378 GTGGCACTGGCCACTCTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169422947 Original CRISPR GTGAGGTCCATCCTCTGGGA AGG (reversed) Intergenic