ID: 1169422950

View in Genome Browser
Species Human (GRCh38)
Location 20:5474329-5474351
Sequence GACCTCACGTGACTGCTGCG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169422947_1169422950 -8 Left 1169422947 20:5474314-5474336 CCTTCCCAGAGGATGGACCTCAC No data
Right 1169422950 20:5474329-5474351 GACCTCACGTGACTGCTGCGTGG No data
1169422944_1169422950 5 Left 1169422944 20:5474301-5474323 CCATCAGGGAGGGCCTTCCCAGA 0: 1
1: 1
2: 2
3: 28
4: 270
Right 1169422950 20:5474329-5474351 GACCTCACGTGACTGCTGCGTGG No data
1169422937_1169422950 29 Left 1169422937 20:5474277-5474299 CCTGTGGTCAGAATCGCAGAGGG No data
Right 1169422950 20:5474329-5474351 GACCTCACGTGACTGCTGCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169422950 Original CRISPR GACCTCACGTGACTGCTGCG TGG Intergenic