ID: 1169426172

View in Genome Browser
Species Human (GRCh38)
Location 20:5498931-5498953
Sequence GAGAGTTCTTCTTAGGCCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 138}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169426165_1169426172 16 Left 1169426165 20:5498892-5498914 CCATGTGCACTGGGTGGGGCTTT 0: 1
1: 1
2: 3
3: 21
4: 203
Right 1169426172 20:5498931-5498953 GAGAGTTCTTCTTAGGCCCTGGG 0: 1
1: 0
2: 1
3: 9
4: 138
1169426161_1169426172 23 Left 1169426161 20:5498885-5498907 CCTCAGGCCATGTGCACTGGGTG No data
Right 1169426172 20:5498931-5498953 GAGAGTTCTTCTTAGGCCCTGGG 0: 1
1: 0
2: 1
3: 9
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169426172 Original CRISPR GAGAGTTCTTCTTAGGCCCT GGG Intergenic
904413164 1:30337205-30337227 GAGAGGTCCACTTAGGCTCTGGG + Intergenic
908097905 1:60759459-60759481 GAGAGTGTTTCTGAAGCCCTGGG - Intergenic
911627106 1:100136713-100136735 GAGAGTTTTTGTTAAACCCTTGG + Intronic
912455575 1:109794633-109794655 GGAAGTTCTCCTTGGGCCCTGGG - Intergenic
915660605 1:157402243-157402265 GAGTTTTCTTTATAGGCCCTGGG + Intergenic
915680526 1:157577716-157577738 GAGAGTTCTCCTCAGGTCTTAGG + Intronic
918421012 1:184364195-184364217 GATGTTTCTTCTTAGGCCATTGG + Intergenic
920561170 1:206939480-206939502 GAGAGGCTTTCTGAGGCCCTTGG + Intronic
921167860 1:212519747-212519769 GAGATGCCTTCTTAGTCCCTGGG + Intergenic
924425538 1:243946709-243946731 GAGGATTCTTCTGAGGCTCTGGG - Intergenic
1067187854 10:44045206-44045228 GAGTGTTGTTCCCAGGCCCTGGG + Intergenic
1067794580 10:49311466-49311488 GAGTGTACTTCTTGGACCCTGGG - Intronic
1071321267 10:84461165-84461187 GAGACTTCTTCTTTGACCCAAGG + Intronic
1074122367 10:110502163-110502185 CAGTGTTCTTCTTAGCACCTTGG + Intronic
1075858813 10:125656172-125656194 GAGAGATCTTCTTACGTCCCAGG + Exonic
1081929337 11:46857920-46857942 GATACTTCTCTTTAGGCCCTGGG + Exonic
1082307807 11:50603755-50603777 GAGAGTTGTTTTTTGGCCTTTGG - Intergenic
1086532647 11:87803878-87803900 GAAAGTTATTCTCAGGCCTTGGG - Intergenic
1087436221 11:98121387-98121409 GAGACTTCTTCTTTTTCCCTTGG - Intergenic
1090374377 11:126278614-126278636 CAGAGTCCTTCTTAGATCCTAGG + Intergenic
1093897098 12:24585922-24585944 GAAACTTCTTCTTTGGCCCATGG - Intergenic
1097728093 12:63097488-63097510 GAGAGTTCTTTTTAGACCATGGG - Intergenic
1103076183 12:117984559-117984581 GAGAGTTCTTAATAAACCCTGGG - Intergenic
1103394910 12:120600048-120600070 GCAAGTTCTTCCTAGGGCCTTGG - Intergenic
1106396785 13:29388077-29388099 GACAGTCCTTCTTGGGCTCTGGG - Intronic
1108667859 13:52650809-52650831 GTAAGTTCTTCTTAGACCATAGG - Intergenic
1110557324 13:76875106-76875128 GAGAGTTCTCCTTAGATACTGGG + Intergenic
1112869893 13:103957573-103957595 GTGAGTTCTTCTTGGCCTCTCGG - Intergenic
1113278044 13:108756430-108756452 GAAAGTTTTTCTTAGACCTTGGG - Intronic
1115677535 14:35696083-35696105 AAGAGTTTTTCTTAAGCTCTGGG - Intronic
1117232628 14:53736867-53736889 GAGACTTCTTATGAGGCACTAGG + Intergenic
1117372849 14:55094418-55094440 GAGGTTTCTTCTTAAGGCCTGGG - Intergenic
1117689611 14:58293181-58293203 GAGAATTTTTCTTGGACCCTAGG - Intronic
1119763963 14:77176345-77176367 GAGAGTTTTTATTTGGCTCTTGG + Intronic
1120598873 14:86475338-86475360 GAAAGATCTTCTTAGACTCTAGG + Intergenic
1124530892 15:30504987-30505009 GAGATTTCTTCTTTGGCTCATGG - Intergenic
1124634777 15:31358024-31358046 CAGAGTTCCTGTTAGGCCTTTGG + Intronic
1124767766 15:32502708-32502730 GAGATTTCTTCTTTGGCTCATGG + Intergenic
1125065399 15:35478605-35478627 TTGAGTTCCTCTGAGGCCCTAGG - Intronic
1126446508 15:48751923-48751945 GTGAGTTTTTCTGAGGGCCTGGG - Intronic
1128596330 15:68954299-68954321 GAGACTTCCTCTTTGGCCCACGG + Intronic
1128846807 15:70905928-70905950 GAGAATTCTTTTTATGGCCTCGG + Intronic
1129914736 15:79258862-79258884 GAGAGAAGTTCTTGGGCCCTAGG + Intergenic
1132174230 15:99696499-99696521 GAGATTTCTTCTCTGGTCCTTGG - Intronic
1137784262 16:51124975-51124997 GGAAGTCCTTCTCAGGCCCTGGG - Intergenic
1138011538 16:53385458-53385480 GAGACTTCTTCTTTGACCCATGG + Intergenic
1143255188 17:5552235-5552257 GTGATTTCTTCTTTGACCCTTGG + Intronic
1144006165 17:11101635-11101657 GTGAGTGCTTGTTAGGCCCCAGG - Intergenic
1147990380 17:44329007-44329029 GAGATGTCTTCCTAGGCCCTGGG - Intergenic
1148660702 17:49329944-49329966 TTGATTTCTTCTTTGGCCCTGGG - Intronic
1150706388 17:67491083-67491105 GTGACTTCTTCTTAAGCCCATGG + Intronic
1150717920 17:67587625-67587647 GAAGGTCCTTCTTAGGACCTGGG - Intronic
1151482976 17:74381001-74381023 CAGAGTTATTCTTGGGACCTAGG - Intergenic
1152132851 17:78487449-78487471 GAGCTTCCTGCTTAGGCCCTGGG - Intronic
1152907848 17:82978882-82978904 GAGACTTCCTCTTTGGCCCATGG - Intronic
1152975120 18:208622-208644 GAGACTTCCTCTTTGGCCATTGG + Intronic
1155463737 18:26113080-26113102 GTGAATTCTTCTTTGACCCTTGG + Intergenic
1159282482 18:66304813-66304835 GAGAGTTATTCTCATGCCCCAGG + Intergenic
1167300724 19:48676036-48676058 GAGCATTTTTCTTAGGCCTTAGG + Intergenic
1167426072 19:49430398-49430420 GAGAGTGCTTCTTAGGCCTGAGG + Exonic
930968484 2:57363177-57363199 GTGATTTCTTCTTTGTCCCTTGG - Intergenic
933285314 2:80378904-80378926 GAGAGTTCTGTGTAGGCTCTGGG + Intronic
936490774 2:112970360-112970382 TACATTTCTTCTTAGTCCCTTGG - Intergenic
937513723 2:122628787-122628809 TTTAGTTCTTCTTATGCCCTTGG + Intergenic
940421101 2:153479495-153479517 AGGAGTTCTTCTGTGGCCCTTGG + Intergenic
942279493 2:174345478-174345500 GAGGATTCTTCTTAGGCTTTAGG + Intergenic
945028578 2:205642652-205642674 GAAAGGTGTTCTTTGGCCCTGGG - Intergenic
947970655 2:234320580-234320602 GAGGTTTCATTTTAGGCCCTCGG + Intergenic
1169426172 20:5498931-5498953 GAGAGTTCTTCTTAGGCCCTGGG + Intergenic
1169428280 20:5512893-5512915 GAGAGCCATTCTTAGGCCCTGGG + Intergenic
1170086254 20:12535551-12535573 GAGTGTTGTTCTTAGGCCAATGG - Intergenic
1170336625 20:15277268-15277290 GAGAGGTCTGCTGAGGACCTTGG - Intronic
1170976975 20:21173902-21173924 TAGTGTTCTTCTTAGGCCCATGG - Intronic
1172487073 20:35304770-35304792 GAGACTTCATCTTAGGCTTTAGG + Intronic
1173563226 20:44021085-44021107 CCTGGTTCTTCTTAGGCCCTTGG - Intronic
1173823488 20:46032858-46032880 GAGAGCTCTTCTGAGACCCTGGG + Intronic
1173843726 20:46175119-46175141 GAGGGTCCTTCTAATGCCCTGGG - Intronic
1177379037 21:20314361-20314383 CAGAGCTCTTCTTAGGTCATAGG - Intergenic
1178580216 21:33831915-33831937 GAGAGGCCTCCTTAGACCCTCGG + Intronic
1179101737 21:38360447-38360469 GAGGTGTCTTCTTAGGACCTGGG + Intergenic
1181997407 22:26893657-26893679 ATGAGTTCTTCCCAGGCCCTGGG + Intergenic
950478328 3:13228004-13228026 GATGGTTCCTCTGAGGCCCTCGG + Intergenic
955669365 3:61386575-61386597 GAGATTTCTTCTTTGACCCATGG - Intergenic
955750200 3:62179145-62179167 GAGACTGTTTCTTATGCCCTAGG - Intronic
956045776 3:65194355-65194377 GAGAGGTGTTCTTAGGCCAGAGG + Intergenic
959605146 3:108234493-108234515 CAGAGTTCTTCTAAGGCCCCAGG + Intergenic
959643353 3:108666793-108666815 GAGAGCTCTTCTTTGACCCATGG - Intronic
960019541 3:112933116-112933138 CAGATTATTTCTTAGGCCCTGGG - Intronic
967647557 3:191944719-191944741 GACTATTCTTTTTAGGCCCTTGG - Intergenic
970991185 4:22215274-22215296 GAGAATTATTCTTAAGCCCTTGG - Intergenic
971876706 4:32318077-32318099 CAGAGTTTTGCTTGGGCCCTGGG + Intergenic
972200212 4:36705132-36705154 GAGAGTTTTTAATAGGCCCAAGG + Intergenic
972347657 4:38206524-38206546 AAGAGTTCATCTTTTGCCCTAGG - Intergenic
974492279 4:62582329-62582351 AGGAGTTCTTCTTGGACCCTAGG - Intergenic
976871974 4:89805671-89805693 GAGAAATGTTCTTAGGCCTTAGG - Intronic
977977426 4:103282984-103283006 AAGACTTCTTCTTAGTCCCATGG - Intergenic
984940260 4:184925203-184925225 GTGATTCCTTCTTTGGCCCTTGG + Intergenic
989504136 5:42206752-42206774 GAAAGTTCTTCTTAGTTCTTAGG - Intergenic
997293429 5:132754239-132754261 GAGAGTTCTTGATATGACCTAGG - Intronic
998518884 5:142782123-142782145 GAGTTTCCTTCTTAGGCCTTGGG + Intronic
998827368 5:146116642-146116664 GAGAGTGATTCTAAGTCCCTAGG + Intronic
998937689 5:147248245-147248267 GACATTTCTTCATATGCCCTAGG + Intronic
1000451994 5:161400811-161400833 GTGAGTTGTTCTCAGGCTCTGGG + Intronic
1002921286 6:1575197-1575219 CAGAGTTCTGTTAAGGCCCTGGG + Intergenic
1002972042 6:2033404-2033426 GAAAGATTTCCTTAGGCCCTTGG - Intronic
1004148175 6:13089405-13089427 GAGAGGTCTTCTTAGGTGCCTGG + Intronic
1005247836 6:23909082-23909104 TAGAGTCCTTCTTTGTCCCTAGG - Intergenic
1005913566 6:30331594-30331616 GATAGTTCTTCTGAGACTCTTGG - Intronic
1008177579 6:48287894-48287916 GACAGTACTCCTTATGCCCTGGG - Intergenic
1008643814 6:53492814-53492836 GTGATTTCTTCTTTGGCCATGGG - Intergenic
1010879251 6:81148081-81148103 GAGAGTTCCTCTTTGACCCATGG + Intergenic
1011529686 6:88308038-88308060 CAGAGTTCCTCTTTGACCCTTGG + Intergenic
1013079537 6:106800460-106800482 GAAAGCCCTTCTTAAGCCCTGGG - Intergenic
1013246737 6:108294410-108294432 GACAGTCCTTCTTAGGCCCTTGG + Intergenic
1013419453 6:109952774-109952796 GTGGATTCTTCTTGGGCCCTGGG - Intergenic
1013617422 6:111858089-111858111 GACAGTCCTGCTTATGCCCTTGG - Intronic
1013952497 6:115801064-115801086 GAGATTTCTTCTTTTACCCTTGG - Intergenic
1014179749 6:118371826-118371848 AAGACTTCTTCTCTGGCCCTTGG - Intergenic
1015224059 6:130836320-130836342 GAGATCTCTTTTTAGCCCCTGGG + Exonic
1015693489 6:135954273-135954295 GTGAGTTCCTCTTAGGGGCTGGG - Intronic
1016640606 6:146344584-146344606 ATGAGTTTTTATTAGGCCCTCGG + Intronic
1019472881 7:1230442-1230464 GAGAGCTCTTCAGAGGCCCTCGG - Intergenic
1020606867 7:10349527-10349549 GAGTCTTCTTTTTAGCCCCTTGG + Intergenic
1021534532 7:21688482-21688504 GAGAGTTTTTTTAAAGCCCTGGG - Intronic
1024475811 7:49808781-49808803 CAGATTTCTTCATTGGCCCTTGG - Intronic
1027420873 7:78016544-78016566 GAGAGTTCTGCTTGGCCCTTGGG - Intergenic
1032860620 7:135875625-135875647 GAGACTTCTTTTAAGGCCCAAGG - Intergenic
1036780228 8:11641736-11641758 GAGAGCTCTTCTTCTTCCCTGGG + Intergenic
1039658997 8:39442502-39442524 GAGAGTACTTGTTGGGCCATAGG + Intergenic
1039750710 8:40475874-40475896 GAGAGTTCTGTTCAGCCCCTTGG + Intergenic
1039890319 8:41681570-41681592 GAGCCTCCTTCTGAGGCCCTGGG - Intronic
1040455177 8:47590410-47590432 GAGACTTCCTCTTTGACCCTTGG + Intronic
1041755777 8:61311780-61311802 AGAAGTTATTCTTAGGCCCTTGG - Intronic
1043246700 8:78012254-78012276 GACTGCTCTTCTTTGGCCCTTGG - Intergenic
1044348462 8:91134436-91134458 GACACTTCTTCTTCTGCCCTTGG - Intronic
1045050034 8:98315277-98315299 GAGGGTCCTTTTTGGGCCCTGGG + Intergenic
1051799371 9:20914589-20914611 GCGAATTCATCATAGGCCCTGGG + Intronic
1055267628 9:74515810-74515832 CAGAGTTCTTCCTAGTCACTGGG - Intronic
1056087452 9:83165404-83165426 GAGATTTCTTCTTAGACCAGTGG - Intergenic
1058383028 9:104399585-104399607 GAGATTTCTTCTTTGACCCATGG + Intergenic
1060552820 9:124493663-124493685 GAGAGCTCTGCGTAGGCCCGGGG - Intronic
1186278956 X:7972061-7972083 GAGATTTCTTGTTAGGACTTGGG + Intergenic
1189729364 X:44002750-44002772 GTGTGTTCTTTTCAGGCCCTCGG - Intergenic
1193480266 X:82018922-82018944 GAGACTTCTTATGAGGCCATAGG - Intergenic
1197159596 X:123308637-123308659 GAGTATTCTTCTTAGGACTTGGG + Intronic
1197682059 X:129395868-129395890 GATAGTTTTTCTAAGCCCCTGGG + Intergenic
1198047745 X:132919420-132919442 GAGAGTCTTTCTTAGGCTTTTGG - Intronic
1198565041 X:137895675-137895697 GAGAGTTCTGCTTTGGGTCTTGG + Intergenic
1200042061 X:153378078-153378100 CAGACTTCTTCTCAGGTCCTGGG + Intergenic