ID: 1169426478

View in Genome Browser
Species Human (GRCh38)
Location 20:5501146-5501168
Sequence GACCTCACGTGACTGCTGCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169426478_1169426484 5 Left 1169426478 20:5501146-5501168 CCACGCAGCAGTCACGTGAGGTC No data
Right 1169426484 20:5501174-5501196 TCTGGGAAGGTCCTCCCTGATGG 0: 1
1: 1
2: 3
3: 21
4: 268
1169426478_1169426481 -8 Left 1169426478 20:5501146-5501168 CCACGCAGCAGTCACGTGAGGTC No data
Right 1169426481 20:5501161-5501183 GTGAGGTCCATCCTCTGGGAAGG No data
1169426478_1169426490 29 Left 1169426478 20:5501146-5501168 CCACGCAGCAGTCACGTGAGGTC No data
Right 1169426490 20:5501198-5501220 CCCTCTGCGATTCTGACCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169426478 Original CRISPR GACCTCACGTGACTGCTGCG TGG (reversed) Intergenic