ID: 1169429251

View in Genome Browser
Species Human (GRCh38)
Location 20:5521914-5521936
Sequence TTCCCTGTCTCTGCTAGATC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169429248_1169429251 5 Left 1169429248 20:5521886-5521908 CCCATCAGTGGGACACGGCAGAG No data
Right 1169429251 20:5521914-5521936 TTCCCTGTCTCTGCTAGATCTGG No data
1169429244_1169429251 30 Left 1169429244 20:5521861-5521883 CCTTCTACAGAAGATCAGTAGAC No data
Right 1169429251 20:5521914-5521936 TTCCCTGTCTCTGCTAGATCTGG No data
1169429249_1169429251 4 Left 1169429249 20:5521887-5521909 CCATCAGTGGGACACGGCAGAGG No data
Right 1169429251 20:5521914-5521936 TTCCCTGTCTCTGCTAGATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169429251 Original CRISPR TTCCCTGTCTCTGCTAGATC TGG Intergenic
No off target data available for this crispr