ID: 1169430676

View in Genome Browser
Species Human (GRCh38)
Location 20:5533275-5533297
Sequence GGCCAGTGGTCTTGCTGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 236
Summary {0: 1, 1: 6, 2: 3, 3: 26, 4: 200}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169430676_1169430680 -4 Left 1169430676 20:5533275-5533297 CCAGCACAGCAAGACCACTGGCC 0: 1
1: 6
2: 3
3: 26
4: 200
Right 1169430680 20:5533294-5533316 GGCCGCTGTGGCCATACCATGGG 0: 1
1: 0
2: 0
3: 6
4: 49
1169430676_1169430679 -5 Left 1169430676 20:5533275-5533297 CCAGCACAGCAAGACCACTGGCC 0: 1
1: 6
2: 3
3: 26
4: 200
Right 1169430679 20:5533293-5533315 TGGCCGCTGTGGCCATACCATGG 0: 1
1: 0
2: 1
3: 7
4: 87
1169430676_1169430684 24 Left 1169430676 20:5533275-5533297 CCAGCACAGCAAGACCACTGGCC 0: 1
1: 6
2: 3
3: 26
4: 200
Right 1169430684 20:5533322-5533344 CTAAGAAGAAATAAGTTTGTAGG 0: 1
1: 0
2: 9
3: 30
4: 330

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169430676 Original CRISPR GGCCAGTGGTCTTGCTGTGC TGG (reversed) Intergenic
900002210 1:20992-21014 GGCCAGAGGCCGGGCTGTGCTGG + Intergenic
900145828 1:1158325-1158347 GGCCCGAGGTCTCGCTGGGCGGG - Intergenic
902334928 1:15749284-15749306 GGCCAGTGGTCTTTCTGGAGGGG + Intergenic
902378126 1:16039781-16039803 GGCCAGAGGACTTGGTGAGCTGG - Intergenic
905045493 1:34996776-34996798 GGCAAGTAGAGTTGCTGTGCAGG - Intronic
906289556 1:44610860-44610882 GGGCTGTGGTCTTGCTGGGGTGG - Intronic
909137251 1:71817019-71817041 GGCAAGTTGGCTTGCTGTGGAGG - Intronic
911019711 1:93374515-93374537 GGCAAGTGCTCATGCTGTACTGG - Intergenic
911239474 1:95449443-95449465 GGCAAGTGCTGGTGCTGTGCTGG - Intergenic
915272158 1:154760895-154760917 GGCCAGTGGCCTTGGTGGACAGG - Intronic
916734100 1:167591787-167591809 AGCCAGTGGTCTTGGCATGCTGG - Intergenic
919147298 1:193651683-193651705 GGCAAGTGGTAGTGCTGTGGTGG - Intergenic
920254009 1:204642095-204642117 AGCCAGTGCTCTTGCTCTCCTGG + Intronic
920571632 1:207022344-207022366 GGCCAGGGGTGTTGCTCTCCTGG + Exonic
920807690 1:209250624-209250646 GGTCATTGGTATTGCTGTTCTGG - Intergenic
922661098 1:227430921-227430943 AGCCAGTGGTCTTGCTGTGCTGG - Intergenic
923018956 1:230148210-230148232 GGCCACTGATCTGGTTGTGCCGG - Intronic
923726849 1:236513386-236513408 GGCCAGTGGTCTTCCAGTTGGGG + Intergenic
924947426 1:248855837-248855859 CTCCAGTCCTCTTGCTGTGCCGG - Exonic
1063422139 10:5921472-5921494 GGCAAGTGGCCTTGTTGTCCCGG + Exonic
1065928536 10:30458094-30458116 GCCCAGAGGTCATCCTGTGCAGG + Exonic
1067850312 10:49750253-49750275 GGCCAGGGGTCCTGCTGAGTGGG - Intronic
1069623448 10:69852054-69852076 GGCCTTTGCACTTGCTGTGCTGG + Intronic
1070361869 10:75698327-75698349 GGCCAGTGTTCTTACTTTGCTGG - Intronic
1070840980 10:79487727-79487749 CGCCCATGGTCTGGCTGTGCAGG + Intergenic
1074356135 10:112785141-112785163 TGCCAGTGGTGTAGCTGAGCAGG + Intronic
1075399904 10:122153381-122153403 GGCCAGTGTTCTGACTTTGCTGG - Intronic
1076530392 10:131140877-131140899 GGCAAGAGGCCTGGCTGTGCAGG + Intronic
1076763420 10:132616919-132616941 GGCCAGTTGCTTTGCTGCGCTGG + Intronic
1078518356 11:12044373-12044395 GACCCGTGGTCTTGCCGTGGGGG + Intergenic
1080762236 11:35262840-35262862 GACCAGTGGTCAAGCTGAGCAGG - Intronic
1083679513 11:64344701-64344723 GGCCAGTGGTGTCGCAGAGCAGG + Exonic
1083697969 11:64455297-64455319 GGCCAGTGGTCTGGCCATGTCGG + Intergenic
1088034627 11:105296606-105296628 GCCTAGTGGTCTTGCTCAGCGGG - Intergenic
1089218694 11:116852520-116852542 GGCAAGTTATCTTGCTTTGCTGG + Intronic
1090312681 11:125756103-125756125 GCCAAGTGGTCTTGCTCAGCAGG + Intergenic
1090318401 11:125818131-125818153 GCCAAGTGGTCTTGCTCAGCAGG + Intergenic
1090470925 11:126980441-126980463 AGCCAGTGGGCTTGCTGAGAAGG + Intronic
1091375628 12:23052-23074 GGCCAGAGGCCGGGCTGTGCTGG + Intergenic
1093977406 12:25438321-25438343 GGCCAATGGCCTAGTTGTGCAGG - Intronic
1098886810 12:75968851-75968873 GACCTGTGGTACTGCTGTGCAGG + Intergenic
1099943969 12:89222951-89222973 GCCAAGTGGTCTTGCTCAGCAGG - Intergenic
1101963984 12:109269569-109269591 GGACAGAGGTCTTGTTGGGCAGG + Intergenic
1102864910 12:116366751-116366773 GGCCAGTGGCCATGCTGTGCTGG + Intergenic
1104141809 12:125994594-125994616 TGCCAGTGGTCTTTCTGTTCTGG + Intergenic
1104688948 12:130809999-130810021 GACCTGGGGTCTTGCTGTGCTGG - Intronic
1108229082 13:48318757-48318779 GGCCACTGGTCTGGCTGTTGGGG + Intronic
1111041272 13:82751766-82751788 GGACATGGGTCTTTCTGTGCGGG + Intergenic
1112053892 13:95671803-95671825 GGCAAGTCCTCTTGCTGTGCTGG - Intergenic
1112444689 13:99453480-99453502 AGCCAGTGGTGTGGCTCTGCTGG - Intergenic
1113928179 13:113952605-113952627 GGCCAGTGGTCCTGGGGTGGTGG - Intergenic
1115357148 14:32460758-32460780 GCCAAGTGGTCTTGCTCAGCGGG + Intronic
1117191129 14:53292995-53293017 GGCCAGTGTTTTTCCTGGGCTGG + Intergenic
1117850085 14:59958576-59958598 GCCAAGTGGTCTTGCTCAGCGGG - Intronic
1117870688 14:60197704-60197726 GGCAAGTCCTGTTGCTGTGCTGG + Intergenic
1120216416 14:81685216-81685238 GGCCAGTGGTCCTGGTTTTCAGG + Intergenic
1121015433 14:90546166-90546188 GGCCAGTCCTCTAGCTGTGCTGG - Intronic
1121019536 14:90570805-90570827 GCCCGGTGGTGTTGCTGTGCGGG - Intronic
1121941826 14:98078170-98078192 GGACAGTGGTGATGATGTGCAGG - Intergenic
1123060446 14:105592001-105592023 GGCCTGTGGTCTGGCTGTGGTGG + Intergenic
1123084924 14:105712972-105712994 GGCCTGTGGTCTGGCTGTGGTGG + Intergenic
1128606495 15:69040079-69040101 GGCCAGGGGTCCTGCTGGGCTGG - Intronic
1128636463 15:69305570-69305592 GGTCAGTGGCCTTCCAGTGCGGG + Intronic
1129256492 15:74336938-74336960 GGCCAGTGGTCCAGCTGGCCTGG - Intergenic
1131133012 15:89912343-89912365 GGACAGTGGCCGTGCTGTGGCGG - Intronic
1132451300 15:101969947-101969969 GGCCAGAGGCCGGGCTGTGCTGG - Intergenic
1134838201 16:17379550-17379572 GCCCAGTGGCCTGGCTGGGCTGG - Intronic
1139672630 16:68502132-68502154 AGCAAGTGGCCTTGCTGGGCTGG + Intergenic
1142644062 17:1300780-1300802 GGTCAGTGGCCCTGCTGTCCCGG + Exonic
1143023243 17:3927459-3927481 GCCCAGAGGCCTGGCTGTGCAGG + Intronic
1143615197 17:8045479-8045501 GGCCGGGGGTCTGGCTGAGCTGG - Exonic
1144381674 17:14705114-14705136 GGCCAGTGGTCTTGGTGTGCTGG + Intergenic
1144586664 17:16491688-16491710 GGCCAGGGGGCGTGCTGGGCCGG - Intronic
1144632430 17:16881017-16881039 TCCCAGTGGGCTTGCTGGGCAGG + Intergenic
1146641783 17:34547332-34547354 GGGCAGTGGCCTTGTTTTGCAGG + Intergenic
1149008519 17:51830896-51830918 GGCCTGTGGTCTAGCTGTGAAGG - Intronic
1150206439 17:63412181-63412203 GTCCAGTGGTCTGGCTGCCCTGG + Intronic
1152640868 17:81448697-81448719 GGCCCGTGGTCACCCTGTGCTGG + Intronic
1152770571 17:82165729-82165751 TGTCAGAGGTTTTGCTGTGCTGG - Intronic
1154101566 18:11479384-11479406 GCCAAGTGGTCTTGCTCAGCAGG - Intergenic
1160049798 18:75422106-75422128 GGCCAGTGGCCCTGCTGGGTGGG - Intronic
1160418365 18:78727458-78727480 GGCCTGGGGTCTTGCTGGCCTGG - Intergenic
1160633963 19:62600-62622 GGCCAGAGGCCGGGCTGTGCTGG + Intergenic
1160806285 19:993601-993623 GGGCAGTGGCCTTGCTGGGCCGG + Intronic
1161236510 19:3201058-3201080 GGCATGTGGTCGGGCTGTGCAGG + Intronic
1161560105 19:4968600-4968622 GGCCGGTGCTGATGCTGTGCTGG + Intergenic
1163565544 19:18049034-18049056 GGCCAATGGTCTCGGTGTGCTGG - Intergenic
1164269538 19:23659369-23659391 GACAAATTGTCTTGCTGTGCAGG - Intronic
1166326176 19:42052442-42052464 GGCCAGTGATCCTGTTGTGGAGG - Intronic
925951630 2:8918858-8918880 GGGCAGCGGTCTTGCAGTGATGG - Intronic
928130101 2:28642985-28643007 GGACAGTGGTCTGGAGGTGCAGG + Exonic
928178628 2:29052045-29052067 TGCCAGTTGTCTTGCTGTCAGGG - Exonic
929552633 2:42904241-42904263 GGACAGTGTTCTTCCTGTCCAGG + Intergenic
929751292 2:44716346-44716368 AGCCAGTGATCTTGGTGTGCTGG + Intronic
932411374 2:71549877-71549899 GGCCAGTGCCCTGTCTGTGCTGG + Intronic
934780653 2:96967710-96967732 GCCCTCTGGTCTTGCTGTGTTGG - Intronic
935852241 2:107235503-107235525 GCCAAGTGGTCTTGCTCAGCAGG + Intergenic
937419700 2:121743496-121743518 TGCCAGTGGTCTTGGCGTGCTGG + Intronic
938571885 2:132568889-132568911 AGCCAGTGGCCTTGCTGGGCAGG + Intronic
940218815 2:151329169-151329191 GGTCAGTTGCCTGGCTGTGCAGG - Intergenic
941765115 2:169288491-169288513 GGCCAGTGCCTTTGCTGGGCTGG - Intronic
943660467 2:190554344-190554366 GCCAAGTGGTCTGGCTCTGCAGG + Intergenic
944100369 2:196019910-196019932 GGAGATTGGTCTTGCTGTGCGGG - Intronic
944225959 2:197348870-197348892 GGCCAGGGTGCATGCTGTGCAGG + Intergenic
945482222 2:210357647-210357669 GCCAAGTGGTCTTGCTCAGCAGG - Intergenic
947475685 2:230445919-230445941 GGTGGGTGGGCTTGCTGTGCTGG - Intronic
947943132 2:234076107-234076129 AGTCTGGGGTCTTGCTGTGCTGG + Intronic
948031828 2:234824327-234824349 GGCCAGTGCTCCTGCTGTGTGGG - Intergenic
948762998 2:240204170-240204192 GGCCCGTGAGCTGGCTGTGCTGG - Intergenic
1168992217 20:2104111-2104133 GGCAAGAGGTCTTGCAGTCCTGG + Intronic
1169388918 20:5173736-5173758 AGCCCGTGGTCTTGCAGAGCAGG + Intronic
1169430676 20:5533275-5533297 GGCCAGTGGTCTTGCTGTGCTGG - Intergenic
1173523161 20:43713759-43713781 GGCCAGTGGACTTGCTGTGCCGG + Intronic
1173954987 20:47024650-47024672 GGCCCGTGGTCTCTCTGAGCTGG - Intronic
1173981032 20:47224346-47224368 GGCCAGTGGGCTTGCTGGCAGGG + Exonic
1174005907 20:47410526-47410548 TTCCATTGGTGTTGCTGTGCTGG + Intergenic
1174421587 20:50402498-50402520 GGCCTGTGCTCTTTCTGTCCTGG - Intergenic
1175243138 20:57564403-57564425 TGCCAGAGGCCTTGGTGTGCCGG + Intronic
1175563431 20:59953182-59953204 GGACAGTGGTCTGGCTGGTCAGG + Intergenic
1175563706 20:59955156-59955178 GGACAGTGGTCTGGCTGGCCAGG - Intergenic
1175698624 20:61121469-61121491 GGACAGGGGTCATGCTGTCCTGG - Intergenic
1176071797 20:63230787-63230809 TCCCAGGGTTCTTGCTGTGCCGG + Intergenic
1179410715 21:41160900-41160922 GGACAGTGTTCTTGGTGCGCTGG + Intergenic
1180835738 22:18928639-18928661 GGGCATTGGTCTGGCTGTGCAGG - Intronic
1181972725 22:26704663-26704685 GCCCACTGGGCTTGCTCTGCAGG + Intergenic
1182612408 22:31559879-31559901 GGCCAGTGGTCTTGGTGTGCTGG - Intronic
1183182729 22:36271846-36271868 GCCAAGTGGTCTTGCTCAGCAGG - Intergenic
1203285827 22_KI270734v1_random:153938-153960 GGGCATTGGTCTGGCTGTGCAGG - Intergenic
949781862 3:7698598-7698620 GGCCTGTGGTTTAGCTGTACTGG - Intronic
950042936 3:9931922-9931944 GGCCCTTGATCTTGCTGTCCTGG - Intronic
951826653 3:26876027-26876049 GCCAAGTGGTCTTGCTCAGCGGG + Intergenic
952301509 3:32107782-32107804 GGCCACTGGCCTTGCTGGGATGG - Intronic
953217165 3:40930425-40930447 AGCCAGTGGACTTGGTGGGCAGG + Intergenic
954795197 3:53157830-53157852 GGCCAGTGCTCTGGGTGTGATGG + Intronic
956220069 3:66893215-66893237 GCCAAGTGGTCTTGCTCAGCGGG + Intergenic
957264702 3:77948204-77948226 GAAAAGTGGTTTTGCTGTGCTGG - Intergenic
958434541 3:94080858-94080880 GCCAAGTGGTCTTGCTCAGCAGG - Intronic
959056951 3:101576527-101576549 GGCCAGTGGTCTTGGTGTGCTGG + Intronic
960471910 3:118076125-118076147 GGCAAGTCGTTATGCTGTGCTGG - Intergenic
961544547 3:127623291-127623313 GTCCAGTGGTCTTGGAGAGCTGG + Intergenic
961609883 3:128128172-128128194 AGACAGGGGTCTTGCTGTGTTGG + Intronic
961811242 3:129523116-129523138 GGCCAGTGTTCTGGATCTGCAGG - Intergenic
963946091 3:151146895-151146917 GGCCAGTGGTCTGACTCTGCTGG + Intronic
964151596 3:153532015-153532037 AGCCAGTGGACTTGGTGGGCAGG + Intergenic
964232467 3:154486969-154486991 GCCAAGTGGTCTTGCTCAGCAGG + Intergenic
965801318 3:172496864-172496886 GCCCAGTGGTCTTGCTCAGTGGG - Intergenic
966903984 3:184508567-184508589 GGCAAGTGGTCCTGCCCTGCTGG - Intronic
967088323 3:186113742-186113764 GGGAAGTGTTCTTGCAGTGCTGG - Intronic
968703363 4:2067019-2067041 AGCCACGGGTCTTGCTGTGCTGG + Exonic
972479704 4:39485770-39485792 GGCCTGAGGTTTTTCTGTGCAGG - Intergenic
972918759 4:43911127-43911149 GGCCAGTGATCTAGGTGTGGGGG - Intergenic
974456173 4:62131317-62131339 GGCCAGTGGTGTTCCTGTGCTGG - Intergenic
977887870 4:102273134-102273156 GCCAAGTGGTCTTGCTCAGCGGG + Intronic
978186076 4:105858361-105858383 GCCGAGTGGTCTTGCTGAGCGGG - Intronic
980148734 4:129021379-129021401 GCCAAGTGGTCTTGCTCGGCGGG + Intronic
982393606 4:154892182-154892204 GCCAAGTGGTCTTGCTCAGCGGG + Intergenic
982719670 4:158847195-158847217 GGCCAGTTCTGATGCTGTGCTGG + Intronic
982969516 4:161965727-161965749 GGCCCTTGTTCATGCTGTGCTGG + Intronic
983665677 4:170179678-170179700 GGCAAGTGGACTTGCTGTTGGGG + Intergenic
985801985 5:2010535-2010557 GGCCAGTCTTCGTCCTGTGCAGG - Intergenic
987704635 5:21446969-21446991 GCCAAGTGGTCTGGCTCTGCAGG - Intergenic
990233921 5:53745956-53745978 GGCCAGTGTGCTCGCTGGGCAGG - Intergenic
992383865 5:76265404-76265426 GCCAAGTGGTCTTGCTCAGCAGG - Intronic
993673941 5:90795187-90795209 GCCAAGTGGTCTTGCTCAGCAGG + Intronic
994641947 5:102421310-102421332 GCCAAGTGGTCTTGCTCAGCAGG + Intronic
997217861 5:132129370-132129392 GCCAAGTGGTCTTGCTCAGCAGG - Intergenic
999030089 5:148281235-148281257 GCCAAGTGGTCTTGCTCAGCAGG - Intronic
999257633 5:150218582-150218604 GGCCTGTGTTCTTACTGTGAAGG + Intronic
999502397 5:152160259-152160281 GCCAAGTGGTCTTGCTCAGCAGG - Intergenic
999602578 5:153283088-153283110 GCCAAGTGGTCTTGCTCAGCGGG + Intergenic
1001085935 5:168700118-168700140 GCCCAGTGCCCGTGCTGTGCTGG - Intronic
1001205516 5:169759036-169759058 AGCAAGTGGTGTTGCTATGCAGG + Intronic
1003071445 6:2948330-2948352 TCCCGTTGGTCTTGCTGTGCTGG + Exonic
1005037489 6:21570106-21570128 GGCAAGTGCTGGTGCTGTGCTGG - Intergenic
1006313276 6:33276406-33276428 GGCCAGTGGTCTTGGTGTGCTGG - Exonic
1006835777 6:36998072-36998094 GGGCAGCGGGCTGGCTGTGCAGG + Intergenic
1009790783 6:68399489-68399511 GCCCAGAAGGCTTGCTGTGCTGG + Intergenic
1011242246 6:85285405-85285427 GGCCTCTGGGCTTGCAGTGCTGG - Intergenic
1012113308 6:95262459-95262481 TGCCAGACATCTTGCTGTGCAGG + Intergenic
1014584589 6:123182628-123182650 GCCAAGTGGTCTTGCTCAGCAGG + Intergenic
1014902384 6:126983854-126983876 GCCAAGTGGTCTTGCTCAGCAGG + Intergenic
1016952577 6:149594483-149594505 AGCCTGTGGTCTTGGTGTGCTGG - Intergenic
1017928287 6:158929601-158929623 TGCCAGTGGACTTGGTGTGTGGG + Intergenic
1019144845 6:169969980-169970002 GGGCTGTGGCCTGGCTGTGCTGG + Intergenic
1020693828 7:11391544-11391566 GCCAAGTGGTCTGGCTGGGCAGG - Intronic
1022750446 7:33219150-33219172 CGCCAGTGGTCTGGCACTGCTGG - Intronic
1023663158 7:42491347-42491369 TGCCAGTGACCTTGGTGTGCAGG + Intergenic
1025249231 7:57340966-57340988 GGCCTGTGCTCTTTCTGTCCTGG + Intergenic
1025291702 7:57731640-57731662 GGACTGTGGTCTTCCTGTACTGG + Intergenic
1029338020 7:99919072-99919094 GGCCAGTGTGCCTGGTGTGCAGG - Exonic
1029704751 7:102270343-102270365 GGCCAGGAGACTGGCTGTGCGGG - Intronic
1030096659 7:105906639-105906661 GGCCATTGGTCATGGTGTCCTGG + Intronic
1032091605 7:128914260-128914282 GGGCACTGGCCTAGCTGTGCTGG + Intergenic
1034163354 7:149007972-149007994 GGCCTGTGGTCTCTCTTTGCCGG - Intronic
1035059963 7:156062032-156062054 GGCCTGTGGTCTGGCTGGACAGG + Intergenic
1037971330 8:23173985-23174007 GGCCAGTGGGCTGGCACTGCTGG + Intergenic
1038949414 8:32398309-32398331 AGCCAGTGGGGTTGCTGTGAGGG - Intronic
1039431576 8:37529158-37529180 TGCCAGGGTTCTGGCTGTGCCGG - Intergenic
1039900843 8:41751643-41751665 GGCCAGAGGACTTGCTGCCCAGG - Intronic
1040447630 8:47511692-47511714 GGCAAATGGTCTTGGTGTACTGG + Intronic
1041171058 8:55142134-55142156 GGCCAGTGGGCTCCCTGTGGGGG - Exonic
1042593798 8:70424163-70424185 GGCCAGTGGTCTTAATGTGCTGG + Intergenic
1042821814 8:72937547-72937569 TGGCAGTGGCCTGGCTGTGCTGG - Exonic
1048337521 8:133514284-133514306 GGCCAGGGAGCTTGCTGTACTGG - Intronic
1049885018 9:21105-21127 GGCCAGAGGCCGGGCTGTGCTGG + Intergenic
1050238900 9:3613382-3613404 GGCAAGTCTTATTGCTGTGCTGG - Intergenic
1051021406 9:12547948-12547970 GGGCAGTGCTCATGCTATGCGGG + Intergenic
1052976422 9:34413959-34413981 GGGCTGTGGTCTTCCTGTTCAGG + Intronic
1057270554 9:93648242-93648264 TCCCAGTGGTGTTGCTGAGCAGG + Intronic
1057606409 9:96500882-96500904 GGCCAGTGTGCTCGCTGGGCTGG - Exonic
1057694710 9:97314946-97314968 GGTGAGTGGTTTTCCTGTGCAGG + Exonic
1058492332 9:105515881-105515903 GCCAAGTGGTCTGGCTGGGCGGG + Intronic
1059251338 9:112890268-112890290 GGCCAGTGGAGGTGCTGTACGGG - Exonic
1059385379 9:113960250-113960272 GGACAGTGGGCTCTCTGTGCTGG + Intronic
1059448629 9:114356118-114356140 GGCTAATGTTCCTGCTGTGCTGG + Exonic
1060810599 9:126609818-126609840 TGTCTGTGGTCTTGCTGTGCCGG - Intergenic
1061206087 9:129164278-129164300 GGCCAGTGGCCTTCTTGTTCTGG + Intergenic
1062020811 9:134318581-134318603 GGCCCGTGGTCATGCTCAGCAGG - Intronic
1188716516 X:33465208-33465230 GCCCAGTTCTCTTGCTGTGCTGG - Intergenic
1188797530 X:34484175-34484197 GGCCTGGGGGCTTGTTGTGCAGG + Intergenic
1189411972 X:40780344-40780366 GGCAAGTGTTGGTGCTGTGCTGG - Intergenic
1189996988 X:46648307-46648329 GGCCAGTGGTCTTTCTCATCAGG + Intronic
1190046112 X:47112755-47112777 GGCAAGTCCTGTTGCTGTGCTGG + Intergenic
1190152092 X:47957291-47957313 GGCCTGTGGTGTTGATTTGCTGG + Intronic
1190152367 X:47958803-47958825 GGCCCGTGGTGTTGATTTGCTGG + Intronic
1190470102 X:50770131-50770153 GGGCAGGGGAGTTGCTGTGCTGG - Intronic
1191799935 X:65067091-65067113 GTCAAGTGGTCTTGCTGAGCAGG - Intergenic
1192884283 X:75320503-75320525 GGCAAGTGGTCTTGCTTAGTGGG - Intergenic
1193398114 X:81010190-81010212 GCCAAGTGGTCTTGCTCAGCAGG - Intergenic
1196047296 X:111269778-111269800 AGCCAGTGGTCTTCCTGCCCTGG - Intronic
1196476460 X:116092142-116092164 GCCAAGTGGTCTTGCTCAGCGGG - Intergenic
1197035739 X:121871003-121871025 GGCCAGTGGTGTTGGGGTGGGGG - Intergenic
1197819266 X:130529326-130529348 GGGCAGTGGCCCTGCTGGGCAGG + Intergenic
1197857474 X:130931657-130931679 TGCAACTGTTCTTGCTGTGCAGG + Intergenic
1198259238 X:134951269-134951291 GCCAAGTGGTCTGGCTGAGCGGG + Intergenic
1198812072 X:140546234-140546256 GGCCATTGGGTTTCCTGTGCTGG + Intergenic