ID: 1169431807

View in Genome Browser
Species Human (GRCh38)
Location 20:5542961-5542983
Sequence AGCTTTATGTTATGTGTGTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169431807_1169431809 4 Left 1169431807 20:5542961-5542983 CCTAACACACATAACATAAAGCT No data
Right 1169431809 20:5542988-5543010 TAATCGCATGGATGACTCCCAGG No data
1169431807_1169431813 29 Left 1169431807 20:5542961-5542983 CCTAACACACATAACATAAAGCT No data
Right 1169431813 20:5543013-5543035 CCACACACTGAGACAGAACTTGG No data
1169431807_1169431814 30 Left 1169431807 20:5542961-5542983 CCTAACACACATAACATAAAGCT No data
Right 1169431814 20:5543014-5543036 CACACACTGAGACAGAACTTGGG No data
1169431807_1169431808 -8 Left 1169431807 20:5542961-5542983 CCTAACACACATAACATAAAGCT No data
Right 1169431808 20:5542976-5542998 ATAAAGCTATACTAATCGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169431807 Original CRISPR AGCTTTATGTTATGTGTGTT AGG (reversed) Intergenic
No off target data available for this crispr