ID: 1169432056

View in Genome Browser
Species Human (GRCh38)
Location 20:5545394-5545416
Sequence TGTGATGCACAGCCTGATCA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 119}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169432053_1169432056 26 Left 1169432053 20:5545345-5545367 CCTGGCAGATGAGACAAAGATCA 0: 1
1: 0
2: 0
3: 17
4: 204
Right 1169432056 20:5545394-5545416 TGTGATGCACAGCCTGATCAAGG 0: 1
1: 0
2: 0
3: 6
4: 119
1169432054_1169432056 -3 Left 1169432054 20:5545374-5545396 CCTACCTAGAACAGAATTACTGT 0: 1
1: 0
2: 0
3: 4
4: 127
Right 1169432056 20:5545394-5545416 TGTGATGCACAGCCTGATCAAGG 0: 1
1: 0
2: 0
3: 6
4: 119
1169432055_1169432056 -7 Left 1169432055 20:5545378-5545400 CCTAGAACAGAATTACTGTGATG 0: 1
1: 0
2: 1
3: 38
4: 211
Right 1169432056 20:5545394-5545416 TGTGATGCACAGCCTGATCAAGG 0: 1
1: 0
2: 0
3: 6
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169432056 Original CRISPR TGTGATGCACAGCCTGATCA AGG Exonic
902721595 1:18307893-18307915 TCTGAAGCACAGCATGAGCAAGG - Intronic
903173078 1:21565529-21565551 TGTCAGGGACAGCCTGAGCAGGG + Intronic
905147683 1:35900945-35900967 TGTGATCCAGAGCCAGATCTGGG - Intronic
906381313 1:45333593-45333615 CCTGATGCACAGCCTGTGCAGGG - Exonic
907482349 1:54754065-54754087 GGTGAGCCTCAGCCTGATCACGG - Intergenic
908286347 1:62607878-62607900 CGTGTTGCACAGGCTGATCTTGG - Intronic
914789158 1:150861292-150861314 TGTGTTTCCCAGCCTGATCTTGG - Intronic
916024955 1:160825498-160825520 TGAAATGGACAGCCAGATCAAGG - Intronic
916832852 1:168510659-168510681 TCTGATGCACGGCAAGATCATGG + Intergenic
917687952 1:177437138-177437160 TGTCATACACAGCATGATCCTGG + Intergenic
921192380 1:212722158-212722180 TGTGAGGCACAGAGTGAGCACGG - Intergenic
1065974021 10:30826982-30827004 TGGGATGGAAAGCCTGACCAGGG - Intronic
1067568580 10:47355345-47355367 TGGGAAGCAGAGCCTGTTCAGGG - Intronic
1070726926 10:78798540-78798562 TCTGATTCACAGGCTGATTACGG + Intergenic
1077200043 11:1302198-1302220 TGTGATTCACATCCAGATCCGGG + Intronic
1079259395 11:18863853-18863875 GGTCATGTACAGCCTGGTCAAGG + Intergenic
1081260327 11:40952091-40952113 TGTGATGCACATACTGTCCAAGG + Intronic
1086348085 11:85918335-85918357 TGATAAGCACAGACTGATCAGGG - Intronic
1086477239 11:87189864-87189886 TGGAATGCAAAGCATGATCAAGG - Intronic
1087617664 11:100506891-100506913 TCTGATGCCCAGCCTGATTTAGG + Intergenic
1090180613 11:124695953-124695975 TCTGTTGCAGAGCCTGATAAAGG - Exonic
1092932826 12:13333267-13333289 TGTGTTGCCCAGGCTGATCTTGG + Intergenic
1093447269 12:19274765-19274787 TGTAGTGCACAGTCTGAGCAGGG - Exonic
1098273753 12:68793485-68793507 TGTGAGGCAGATCCTCATCAGGG + Intronic
1101908360 12:108844676-108844698 TGTGCAGCACAGCCTAATTAAGG - Intronic
1102356772 12:112243610-112243632 TGTGACGTACAGCTTGGTCAGGG + Exonic
1104941958 12:132399413-132399435 GGTGCTTCACACCCTGATCAGGG + Intergenic
1105675713 13:22669603-22669625 TGTGATGCACAGTGTGGTCAAGG + Intergenic
1109067444 13:57716522-57716544 TGTGATTCAAAGGCTGATCAGGG - Intronic
1109306310 13:60645803-60645825 TGTGATTCACAGAGTAATCAAGG - Intergenic
1109813991 13:67555209-67555231 TGTGTACCACAGCCTGCTCATGG + Intergenic
1113403265 13:110014974-110014996 TATGATGCACATCCTAATAAGGG - Intergenic
1113608882 13:111629273-111629295 CCTTATGCACAGCCTGTTCAGGG + Intronic
1113765520 13:112878463-112878485 TCTCATGCACAGACTGATCATGG + Intronic
1117293999 14:54362280-54362302 TGTGAGGCACAGCAAGAACACGG - Intergenic
1118754374 14:68828305-68828327 TGGAGTGCACAGCATGATCATGG - Intergenic
1119058234 14:71446048-71446070 TGTGTTGCCCAGGCTGATCTTGG + Intronic
1121832006 14:97060642-97060664 TGTGATGCCCTGCCTCATCTTGG + Intergenic
1123758195 15:23413279-23413301 TGTGTTGCCCAGGCTGGTCAGGG - Intergenic
1125438997 15:39680976-39680998 TGTGGCTCACAGCCTGACCATGG - Intronic
1130607138 15:85328150-85328172 TGTGATGCTGATGCTGATCAAGG + Intergenic
1130680378 15:85991270-85991292 TGTGATGGACAGGCCCATCAGGG - Intergenic
1130936819 15:88477874-88477896 TGCCATGCACGGACTGATCATGG + Exonic
1136052680 16:27663859-27663881 TGGAATGCAGAGCATGATCATGG + Intronic
1138726959 16:59150721-59150743 TGTGTTGCTCAGGCTGGTCATGG + Intergenic
1138730768 16:59192293-59192315 TGTGTTGCACAGACAGCTCAAGG + Intergenic
1140262328 16:73391097-73391119 TGGGAGGCACAGCCTGCACAAGG + Intergenic
1141552490 16:84815533-84815555 GGTGAGGCACAGCCTGAGCTGGG + Intergenic
1141622336 16:85243012-85243034 TGTGTTGCCCAGGCTGGTCACGG + Intergenic
1143141785 17:4745262-4745284 TGTGATGGACGGCCAGACCATGG + Exonic
1143303758 17:5929922-5929944 TGTGAAGGACATCTTGATCACGG - Intronic
1145788523 17:27609740-27609762 TGAGATCCACAGGCAGATCAGGG + Intronic
1146160437 17:30556646-30556668 TCAGATGCACATCCTGAGCACGG + Intergenic
1148624163 17:49056182-49056204 TGAGATGCTCAGCCTCAGCATGG + Intergenic
1151397140 17:73830787-73830809 TGTGATCCACTGCCTGATGCAGG + Intergenic
1152513972 17:80811357-80811379 TGTGATGCACCATCTGAACAGGG - Intronic
1163318099 19:16555215-16555237 TGGGTTGCGCAGCATGATCAGGG + Exonic
1164851461 19:31487703-31487725 TGTTCTGCACAGCGTGATCTTGG + Intergenic
925107341 2:1303468-1303490 TGTGAGGCACAGCTGAATCAGGG + Intronic
927323731 2:21779058-21779080 TATGTTGCACAGGCTGATCTTGG + Intergenic
927467358 2:23347518-23347540 TGTGATGCATTGCCTGTTCCCGG - Intergenic
928147432 2:28791993-28792015 TGTGTTGCCCAGGCTGGTCATGG - Intronic
934684037 2:96307284-96307306 GGTGGGCCACAGCCTGATCATGG - Intergenic
935172749 2:100623425-100623447 TTTGAGGCCCAGCCTGGTCATGG + Intergenic
935943944 2:108269377-108269399 TGAAATGCAGAGACTGATCATGG - Intergenic
937332910 2:121043262-121043284 TGCGAAGCACAGCCTGCCCAGGG - Intergenic
941662722 2:168211888-168211910 TGGTATGCACACCCTGATTATGG - Intronic
1169432056 20:5545394-5545416 TGTGATGCACAGCCTGATCAAGG + Exonic
1175985792 20:62763659-62763681 TGGGAGGCAGAGCCTGAGCAAGG + Intergenic
1180239999 21:46496108-46496130 TGTGGTGCACAGGCTGGTCCTGG + Intronic
1180835621 22:18928167-18928189 TGTGGTCCCCACCCTGATCAGGG - Intronic
1181107567 22:20584101-20584123 AGGCATTCACAGCCTGATCAGGG + Intronic
1183226872 22:36556468-36556490 TGTCAGGCACTGCCAGATCATGG - Intergenic
1183633691 22:39048195-39048217 TGTGATGCAGAGGCTGGACAGGG + Intronic
1185271355 22:49930613-49930635 GGAGATGCACAGCCTGGCCATGG - Intergenic
1203285709 22_KI270734v1_random:153466-153488 TGTGGTCCCCACCCTGATCAGGG - Intergenic
949553248 3:5130223-5130245 TGTGTTGCTCAGCCTGGTCCCGG + Intronic
950674387 3:14545763-14545785 GGAGATGGCCAGCCTGATCATGG + Intergenic
951902525 3:27670885-27670907 TCTGATCCACAGCCAGAACATGG + Intergenic
952224538 3:31361812-31361834 TGTGATGCTCAGCGTAGTCAGGG - Intergenic
957949787 3:87109610-87109632 TGTGATGGACAGCATGATAATGG - Intergenic
962261361 3:133910544-133910566 TGAGATTCTCAGCCTGATCATGG + Intergenic
963332148 3:143926537-143926559 TGTGTTGCAGAGTCTGACCATGG + Intergenic
968140369 3:196251148-196251170 TGTGATCCTCAGCCTCAGCATGG - Intronic
969079859 4:4610011-4610033 TGTGAGCCATAGCCAGATCAAGG + Intergenic
976224915 4:82788301-82788323 TGGGTGGCTCAGCCTGATCAGGG - Intronic
981132928 4:141178366-141178388 TGTGATGCAAAGCTATATCAAGG + Intronic
985536171 5:466859-466881 TGTGGTGCCCAGCCTGAACGTGG + Exonic
991718304 5:69472613-69472635 TGTGCTGCCCAGCTTGATCCTGG + Intergenic
995764767 5:115602797-115602819 TGTGCTGCACCCCCTAATCAGGG - Intronic
998850214 5:146344689-146344711 TGTGAGCCACAGTCTGGTCAGGG + Intergenic
999710803 5:154316622-154316644 TGGGATACACAGTCTAATCAGGG - Intronic
1002350388 5:178579249-178579271 TGTCGTGCACACCCTGAACATGG - Intronic
1003656661 6:8017545-8017567 CGTGATGAACAGCCTGAAGATGG - Intronic
1005195236 6:23275277-23275299 TGTGATGCACAGAATGCTTAAGG - Intergenic
1007476904 6:42125026-42125048 TGTGGCTCACAGCCTCATCATGG + Intronic
1012393588 6:98770600-98770622 AGTAATGCTCAGCCTGAGCAGGG - Intergenic
1012767804 6:103391048-103391070 AGTTATGCACTGCTTGATCATGG + Intergenic
1018831419 6:167446504-167446526 AGTGCTGCACGGCCTGATGAGGG + Intergenic
1022602263 7:31772456-31772478 TGTGATCCACATCCTGAGTAAGG - Intronic
1029333895 7:99883637-99883659 TGGGATGGCCAGCCTAATCACGG - Intronic
1033591908 7:142815969-142815991 TCTTATCCACATCCTGATCAAGG + Intergenic
1034585465 7:152087996-152088018 TCTGATGCACAGCCAGATTTGGG - Intronic
1035025598 7:155823181-155823203 TGTGATGCACAGCTAGAGCCTGG + Intergenic
1036387056 8:8291789-8291811 GGCGATGCTCAGCCTGAGCATGG - Intergenic
1037891344 8:22625330-22625352 TGGGCTGCGCAGCCTGATCCTGG - Intronic
1038172797 8:25153132-25153154 GTTGATCCACAGCCTGTTCAAGG - Intergenic
1039615997 8:38955476-38955498 TGTAGTGACCAGCCTGATCAAGG + Intronic
1043436590 8:80241165-80241187 TTTGTTGCCCAGGCTGATCATGG + Intergenic
1045552611 8:103186072-103186094 TGGGATGCCCAGCCTCTTCAGGG + Intronic
1045655677 8:104383986-104384008 TGTGATGGTCAGCGTGACCAGGG - Intronic
1046344621 8:112906330-112906352 TTTGATGCACTGCCTGATGGGGG - Intronic
1049009251 8:139876339-139876361 TGGGATCCACAGCCTGCTCCAGG + Intronic
1050585849 9:7110595-7110617 TTGGATCCACAGCCTGATTATGG + Intergenic
1051484543 9:17593813-17593835 TGTGCCACACAGCCTGATGACGG - Intronic
1053193950 9:36100353-36100375 TGTAATGCACAGTCAGATCAAGG + Exonic
1054720721 9:68600903-68600925 TGTAATGCACAGCTTGGTAATGG + Intergenic
1055368714 9:75573975-75573997 TGTGAGCCACAGCCAGAACAGGG - Intergenic
1056157469 9:83852577-83852599 TGTTATGCACAGCCTCCTCTTGG - Intronic
1056353075 9:85771522-85771544 TGTTATGCACAGCCTCCTCTTGG + Intergenic
1057477850 9:95419200-95419222 TGTCATGCACAGCATGATACAGG - Intergenic
1060276931 9:122189544-122189566 TGTAGTGCACAGTGTGATCATGG - Intronic
1060389022 9:123263313-123263335 TGTGTTGCCCAGGCTGATCTTGG - Intronic
1062193480 9:135259568-135259590 TGTGCTGCTCAGCATGAACAGGG + Intergenic
1191907511 X:66109108-66109130 TGTGATTCATATCCTCATCAGGG - Intergenic
1198668465 X:139051344-139051366 TAGGATACACAACCTGATCAAGG - Intronic