ID: 1169437023

View in Genome Browser
Species Human (GRCh38)
Location 20:5601812-5601834
Sequence AATGCAGGAGCACCTATAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 104}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169437023_1169437030 25 Left 1169437023 20:5601812-5601834 CCTCTTATAGGTGCTCCTGCATT 0: 1
1: 0
2: 0
3: 4
4: 104
Right 1169437030 20:5601860-5601882 TTTCTCTTTCTGCTGATTCCAGG 0: 1
1: 0
2: 3
3: 46
4: 486
1169437023_1169437031 26 Left 1169437023 20:5601812-5601834 CCTCTTATAGGTGCTCCTGCATT 0: 1
1: 0
2: 0
3: 4
4: 104
Right 1169437031 20:5601861-5601883 TTCTCTTTCTGCTGATTCCAGGG 0: 1
1: 0
2: 1
3: 40
4: 369
1169437023_1169437032 27 Left 1169437023 20:5601812-5601834 CCTCTTATAGGTGCTCCTGCATT 0: 1
1: 0
2: 0
3: 4
4: 104
Right 1169437032 20:5601862-5601884 TCTCTTTCTGCTGATTCCAGGGG 0: 1
1: 0
2: 0
3: 29
4: 306

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169437023 Original CRISPR AATGCAGGAGCACCTATAAG AGG (reversed) Intronic
900958222 1:5901622-5901644 AAGTCAGGAGCATCTCTAAGTGG + Intronic
901114764 1:6834475-6834497 AGTGCAGGAGGACGTATAACTGG - Intronic
903702132 1:25257199-25257221 AAAGCAGGATAACCTATAATTGG - Intronic
907586891 1:55626769-55626791 AATGCTGGAGAAACAATAAGGGG + Intergenic
909926094 1:81439639-81439661 AATGCAGCAGCACCCATGTGAGG + Intronic
911444217 1:97970617-97970639 AAAGGAGGAGCACCAATGAGAGG - Intergenic
911668765 1:100585037-100585059 AATGCAGGAAAAGCTACAAGAGG - Intergenic
912106790 1:106287940-106287962 AATGCTGCAGCAGCAATAAGGGG + Intergenic
914936466 1:151985408-151985430 GATGCATGAAGACCTATAAGAGG - Intronic
915922816 1:159989825-159989847 AAAGCAGCAGCAGCTATAAAGGG + Intergenic
916034639 1:160910819-160910841 AGTGAAGGCGCACCTACAAGGGG + Intergenic
919045223 1:192442698-192442720 ATTGCAGGAGGACCTATGGGTGG - Intergenic
921431629 1:215072723-215072745 AATGCAAGACCATCTTTAAGAGG - Intronic
921631380 1:217437717-217437739 AATGCAGCAGCCCCAGTAAGGGG + Intronic
923093432 1:230756589-230756611 AGTGCAGGACCACTTCTAAGTGG + Intronic
924491893 1:244545984-244546006 TATGCAGCAGCACCAAAAAGTGG + Intronic
1063787044 10:9396435-9396457 AAAGCAGGTGCAACTATGAGTGG + Intergenic
1072978448 10:100079468-100079490 AGTACAGGAGCACCAACAAGGGG + Intronic
1080926825 11:36766192-36766214 AATGCAGGAACACCTGTAACTGG - Intergenic
1081038302 11:38177567-38177589 AATGCAGGTGTACCTCAAAGGGG + Intergenic
1086151507 11:83615732-83615754 AATGCAGCAGCCTCTAGAAGAGG + Intronic
1086666139 11:89485543-89485565 AATTCAAGAGCTCCTATAAATGG + Intronic
1087102912 11:94382001-94382023 AAGGCAGGTACACCTACAAGTGG - Intronic
1088087326 11:105996799-105996821 AATGCAGGAATACTTAAAAGGGG - Intronic
1093399173 12:18722934-18722956 AATGGAAGACCACCTATAACTGG + Intronic
1097094207 12:56532772-56532794 AATAGAGGAACACCTGTAAGAGG + Intronic
1100127836 12:91452193-91452215 TATGTAGGAACACCTACAAGGGG - Intergenic
1102814877 12:115857674-115857696 AATTCTGGAGCACATAGAAGAGG + Intergenic
1105520144 13:21124173-21124195 AATGCAGGAGTACCTAAACTTGG + Intergenic
1107687706 13:42920605-42920627 AAAGCAGGAGCAGGTATATGGGG - Intronic
1110694783 13:78475245-78475267 TTGGCAGGAGCACCTACAAGTGG + Intergenic
1119600438 14:75972455-75972477 AATGCAGGAGCACAGGTGAGGGG + Intronic
1124654718 15:31498992-31499014 ACGGCAGTAGCACCTATAAGAGG + Intronic
1126156487 15:45570251-45570273 ACTGCAGGAGCACCGGTGAGAGG - Intergenic
1126448983 15:48784705-48784727 ACTGCAGAAGCACCTTCAAGGGG - Intronic
1128605477 15:69033572-69033594 TGTGCAGGAGCACCTTCAAGAGG + Intronic
1130704057 15:86215350-86215372 AAAGCAGGAGGACCTTTAAAAGG - Intronic
1131055694 15:89373093-89373115 AATGCAGGTGCCCCTGGAAGTGG - Intergenic
1133007551 16:2893039-2893061 AATGCAGCAGCACGTATGGGAGG + Intronic
1133468197 16:6048319-6048341 AATGCAGAAGCACTGATAATTGG - Intronic
1137567079 16:49539981-49540003 GATGCAGGAGCCGCTCTAAGAGG + Intronic
1144413523 17:15023904-15023926 TATGCAGGGGCACCCAAAAGGGG - Intergenic
1150848354 17:68681409-68681431 TAGGCAGGAGCATATATAAGAGG + Intergenic
1153491593 18:5655199-5655221 GGTGCAGGAGCACCCCTAAGGGG - Intergenic
1162475251 19:10895858-10895880 AATGCTGGAGGACCTCTAGGAGG + Intronic
1166253606 19:41587190-41587212 AATGCAGGAGCATCCATGGGTGG + Intronic
927851125 2:26500245-26500267 AATGCAGTAACACCTATATTTGG + Intronic
929027734 2:37621226-37621248 AATGCATAGGCACCTAGAAGAGG - Intergenic
931270046 2:60693566-60693588 AAGGCAGGAGCACCCACAGGAGG + Intergenic
937603036 2:123762216-123762238 ACTGCAGGAGCATCTGTAGGTGG - Intergenic
940926806 2:159372752-159372774 AATGGAGCAGCAGCTATAAAAGG + Intronic
941107153 2:161367481-161367503 ACTGCAGGAGCATCTGTAGGTGG - Exonic
943815176 2:192245387-192245409 AATCCAGGAGCAGCTTTAATGGG + Intergenic
944560389 2:200930185-200930207 AATGCAGGATAACCTAGAAATGG + Intronic
946316720 2:218920554-218920576 GCTGCAGTAGCACCTACAAGAGG + Intergenic
1169437023 20:5601812-5601834 AATGCAGGAGCACCTATAAGAGG - Intronic
1171154216 20:22857433-22857455 AGTGTAGGAACACCTATAAGGGG + Intergenic
1171251833 20:23654715-23654737 AATGAGGCAGCACATATAAGAGG - Intergenic
1172488883 20:35318118-35318140 AAGGCAGGAGCATCTCTCAGAGG + Intronic
1178383437 21:32130731-32130753 AATGCACGTGCACTTATAAAGGG + Intergenic
1178631228 21:34263208-34263230 ACTGCAGGAGCAACTAAAATAGG - Intergenic
1182388491 22:29968991-29969013 AATGCAGGAGCAAGTATAAATGG - Intronic
956481867 3:69681228-69681250 AGTGAAAGGGCACCTATAAGAGG - Intergenic
963592172 3:147274685-147274707 AATCCAGGAGAATCTACAAGTGG + Intergenic
963986363 3:151599166-151599188 AGGGCAGCAGCAGCTATAAGGGG + Intergenic
964012724 3:151910358-151910380 GTTGCAGGAGAAGCTATAAGGGG + Intergenic
965616889 3:170603099-170603121 AAAGCAAGAGCAACCATAAGTGG - Intronic
967730653 3:192903839-192903861 AATGCAGGAGCAAGCAAAAGTGG - Intronic
973705290 4:53574911-53574933 AAAGCTAGAGCTCCTATAAGGGG + Intronic
975869586 4:78765025-78765047 AAAGTAAGACCACCTATAAGGGG + Intergenic
981417804 4:144513369-144513391 AATGCAGGAGGACCAGTGAGTGG + Intergenic
982859595 4:160432625-160432647 AATACAGGAGCACCTAGACTAGG - Intergenic
986371862 5:7088061-7088083 AATGCAGCAGCACCCAGATGAGG - Intergenic
987594809 5:19983696-19983718 AATGTAGGAGCAGGTGTAAGAGG - Intronic
987669002 5:20984062-20984084 AATGCAGAAGCCACTAGAAGCGG - Intergenic
988359293 5:30213877-30213899 AATACAGGAGCACATAAGAGGGG - Intergenic
989784968 5:45316183-45316205 AATGCAGCAGCACATCTAAAAGG + Intronic
995354516 5:111223619-111223641 ACTGCTGGAGCTCCTAAAAGAGG - Intergenic
999807715 5:155098581-155098603 AATACAGTAGCACCAATATGTGG - Intergenic
1000528521 5:162388677-162388699 AATGCAGGAGAAGTAATAAGTGG + Intergenic
1003239102 6:4326904-4326926 AAAGCAGAAGCACCTAGAATTGG - Intergenic
1008618146 6:53245849-53245871 AATGCATGAGCCCTTAAAAGGGG - Intergenic
1015180397 6:130355743-130355765 AATGGAGAAGCACCAGTAAGAGG + Intronic
1016327996 6:142925075-142925097 AATGCAGGAGACCCAATATGTGG + Intronic
1020460380 7:8423594-8423616 AATGCAGAAGCAATTTTAAGTGG - Intergenic
1021493357 7:21245080-21245102 AATGCAAAAGCACTTCTAAGTGG + Intergenic
1024491789 7:49994252-49994274 TATGCAGGACCACCCAAAAGTGG - Intronic
1025809232 7:64863662-64863684 AGTTCAGGAACACCTTTAAGTGG - Intergenic
1026320234 7:69261627-69261649 AATGCAGTAGTAGCTAAAAGGGG - Intergenic
1026650636 7:72213151-72213173 AATGCATTAGCAATTATAAGAGG - Intronic
1031224916 7:119024006-119024028 AATGCAGAAACAACTATAAAAGG + Intergenic
1031793838 7:126145611-126145633 AATTCAGGAACAGCTATGAGTGG - Intergenic
1035104211 7:156428682-156428704 AAGGCAGGAGCACCAGGAAGGGG + Intergenic
1035104282 7:156429074-156429096 AAGGCAGGAGCACCAGGAAGGGG + Intergenic
1035104325 7:156429298-156429320 AAGGCAGGAGCACCAGGAAGGGG + Intergenic
1045369699 8:101510763-101510785 AATGCATGCGCACTTATATGTGG - Intronic
1046155676 8:110286970-110286992 GATGTGGGAGCACCTAAAAGGGG - Intergenic
1048600049 8:135910171-135910193 AATGCAGTTGCACCTATGAAAGG - Intergenic
1048820719 8:138378263-138378285 AAGGCAGGAGCACCTACTGGTGG + Intronic
1055724121 9:79209309-79209331 AATGCAGCTGCACATATATGAGG + Intergenic
1060558469 9:124522734-124522756 AATGCAGCACCACCTTAAAGAGG + Exonic
1061740971 9:132705774-132705796 ACTGCAGGGGCGACTATAAGAGG + Intergenic
1061913975 9:133739540-133739562 AATCCAGGAGGACCTCTTAGAGG + Intronic
1189016373 X:37289082-37289104 AATGCAGGAGCATGTATGTGTGG + Intergenic
1191810040 X:65176370-65176392 AAGGCAGGAGCCCCAATCAGGGG + Intergenic
1192861969 X:75083982-75084004 ATTACAGGAGTACTTATAAGAGG + Intronic
1198784445 X:140272557-140272579 AAAGCAGGAGCCCCAATTAGGGG - Intergenic
1201997662 Y:20111910-20111932 AATGTAGGAGCAGCCTTAAGTGG + Intergenic
1202256722 Y:22928963-22928985 AACCCAATAGCACCTATAAGAGG + Intergenic