ID: 1169439568

View in Genome Browser
Species Human (GRCh38)
Location 20:5622818-5622840
Sequence CAATGTGCATGGAGAGAAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169439561_1169439568 21 Left 1169439561 20:5622774-5622796 CCTTGCTATATTTTCCTGCTAAA No data
Right 1169439568 20:5622818-5622840 CAATGTGCATGGAGAGAAGGTGG No data
1169439562_1169439568 7 Left 1169439562 20:5622788-5622810 CCTGCTAAAAGAGCAAATTAAAT No data
Right 1169439568 20:5622818-5622840 CAATGTGCATGGAGAGAAGGTGG No data
1169439560_1169439568 22 Left 1169439560 20:5622773-5622795 CCCTTGCTATATTTTCCTGCTAA No data
Right 1169439568 20:5622818-5622840 CAATGTGCATGGAGAGAAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169439568 Original CRISPR CAATGTGCATGGAGAGAAGG TGG Intergenic
No off target data available for this crispr