ID: 1169442442

View in Genome Browser
Species Human (GRCh38)
Location 20:5643969-5643991
Sequence TGGCATTAAAGCCATGGGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169442442_1169442447 30 Left 1169442442 20:5643969-5643991 CCAATCCCATGGCTTTAATGCCA No data
Right 1169442447 20:5644022-5644044 CTCCAGCCCTGATCTCTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169442442 Original CRISPR TGGCATTAAAGCCATGGGAT TGG (reversed) Intergenic
No off target data available for this crispr