ID: 1169444430

View in Genome Browser
Species Human (GRCh38)
Location 20:5659632-5659654
Sequence GCAGGCTTTGAGGGCATCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169444430_1169444440 7 Left 1169444430 20:5659632-5659654 CCTGAGATGCCCTCAAAGCCTGC No data
Right 1169444440 20:5659662-5659684 TGGGGCCCAGAGCTTCCCCCTGG No data
1169444430_1169444441 10 Left 1169444430 20:5659632-5659654 CCTGAGATGCCCTCAAAGCCTGC No data
Right 1169444441 20:5659665-5659687 GGCCCAGAGCTTCCCCCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169444430 Original CRISPR GCAGGCTTTGAGGGCATCTC AGG (reversed) Intergenic