ID: 1169444440

View in Genome Browser
Species Human (GRCh38)
Location 20:5659662-5659684
Sequence TGGGGCCCAGAGCTTCCCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169444435_1169444440 -3 Left 1169444435 20:5659642-5659664 CCTCAAAGCCTGCGCTGGGGTGG No data
Right 1169444440 20:5659662-5659684 TGGGGCCCAGAGCTTCCCCCTGG No data
1169444429_1169444440 21 Left 1169444429 20:5659618-5659640 CCTGTTATAAACTTCCTGAGATG No data
Right 1169444440 20:5659662-5659684 TGGGGCCCAGAGCTTCCCCCTGG No data
1169444430_1169444440 7 Left 1169444430 20:5659632-5659654 CCTGAGATGCCCTCAAAGCCTGC No data
Right 1169444440 20:5659662-5659684 TGGGGCCCAGAGCTTCCCCCTGG No data
1169444434_1169444440 -2 Left 1169444434 20:5659641-5659663 CCCTCAAAGCCTGCGCTGGGGTG No data
Right 1169444440 20:5659662-5659684 TGGGGCCCAGAGCTTCCCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169444440 Original CRISPR TGGGGCCCAGAGCTTCCCCC TGG Intergenic
No off target data available for this crispr