ID: 1169447469

View in Genome Browser
Species Human (GRCh38)
Location 20:5684459-5684481
Sequence TTTTTATTGCCAGCAAAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169447469_1169447470 16 Left 1169447469 20:5684459-5684481 CCTGGCTTTGCTGGCAATAAAAA No data
Right 1169447470 20:5684498-5684520 TAATTTTTAAAATAAAGACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169447469 Original CRISPR TTTTTATTGCCAGCAAAGCC AGG (reversed) Intergenic
No off target data available for this crispr