ID: 1169447470

View in Genome Browser
Species Human (GRCh38)
Location 20:5684498-5684520
Sequence TAATTTTTAAAATAAAGACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169447468_1169447470 24 Left 1169447468 20:5684451-5684473 CCAAACTGCCTGGCTTTGCTGGC No data
Right 1169447470 20:5684498-5684520 TAATTTTTAAAATAAAGACAAGG No data
1169447466_1169447470 28 Left 1169447466 20:5684447-5684469 CCTACCAAACTGCCTGGCTTTGC No data
Right 1169447470 20:5684498-5684520 TAATTTTTAAAATAAAGACAAGG No data
1169447469_1169447470 16 Left 1169447469 20:5684459-5684481 CCTGGCTTTGCTGGCAATAAAAA No data
Right 1169447470 20:5684498-5684520 TAATTTTTAAAATAAAGACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169447470 Original CRISPR TAATTTTTAAAATAAAGACA AGG Intergenic
No off target data available for this crispr