ID: 1169460498

View in Genome Browser
Species Human (GRCh38)
Location 20:5790229-5790251
Sequence TAGGGGAGGAAGGAAGTTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 396
Summary {0: 1, 1: 2, 2: 3, 3: 39, 4: 351}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169460498_1169460508 9 Left 1169460498 20:5790229-5790251 CCTGAAACTTCCTTCCTCCCCTA 0: 1
1: 2
2: 3
3: 39
4: 351
Right 1169460508 20:5790261-5790283 ATACTCTGAGCATGAGGCCTGGG 0: 1
1: 0
2: 0
3: 8
4: 162
1169460498_1169460504 3 Left 1169460498 20:5790229-5790251 CCTGAAACTTCCTTCCTCCCCTA 0: 1
1: 2
2: 3
3: 39
4: 351
Right 1169460504 20:5790255-5790277 ATTCCCATACTCTGAGCATGAGG 0: 1
1: 0
2: 1
3: 11
4: 150
1169460498_1169460507 8 Left 1169460498 20:5790229-5790251 CCTGAAACTTCCTTCCTCCCCTA 0: 1
1: 2
2: 3
3: 39
4: 351
Right 1169460507 20:5790260-5790282 CATACTCTGAGCATGAGGCCTGG 0: 1
1: 0
2: 0
3: 13
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169460498 Original CRISPR TAGGGGAGGAAGGAAGTTTC AGG (reversed) Intronic
900539734 1:3196786-3196808 TAGGGGAGGAAGGAAGTTCAGGG - Intronic
900931128 1:5738486-5738508 GAGGGGAGGAAGGAAGGCTATGG - Intergenic
901033136 1:6320028-6320050 TAGGGGAGGAAGGGAGGTTCTGG + Intronic
902517945 1:16999969-16999991 CAGGGGAGGAAGGAAGCTGCAGG + Intronic
902949390 1:19870007-19870029 GAGGGGAGGACGGAAGCATCAGG - Intergenic
903173088 1:21565574-21565596 GAGGGGAGGGAAGATGTTTCAGG + Intronic
906792833 1:48673927-48673949 CAGGGGAGGAAGGAAGCAGCAGG - Intronic
907481135 1:54746313-54746335 TGGGGGAGGAAGGTGGTTTTGGG - Intergenic
907759291 1:57342188-57342210 AAGGGTTGGAAGGAAGTTCCAGG - Intronic
907768360 1:57434497-57434519 AAGGGGTAGAAGGAACTTTCTGG + Intronic
909607476 1:77521723-77521745 TGAGGGAGGGAGGAAGGTTCAGG - Intronic
911118214 1:94268367-94268389 TAGGGGAGGGTGAAAGTTCCTGG - Intronic
911372504 1:97010936-97010958 GAGGGAAGGAAGGAAGGGTCTGG - Intergenic
911420508 1:97635244-97635266 AATGGGAGGAAGGAAGGTGCGGG - Intronic
913478917 1:119265856-119265878 TAGGAAAGGAAGGAGGATTCAGG + Intergenic
916555299 1:165889613-165889635 GAAGGGAGGAAGGAACTTTGGGG + Intronic
917156820 1:172011272-172011294 CAGGGGAGAAAAGAACTTTCAGG - Intronic
917456057 1:175186987-175187009 TTGGGCAGGAGGGAAGTTTCAGG + Intronic
917612018 1:176698653-176698675 TAGGGAATGAAAGAAGTTTTGGG + Intronic
918851332 1:189694323-189694345 TTAGAGAGTAAGGAAGTTTCAGG + Intergenic
919217997 1:194585550-194585572 GAAGGGAAGATGGAAGTTTCAGG + Intergenic
919529630 1:198700877-198700899 GAGGGAAGGTAGGAAGTTTCGGG + Intronic
919993700 1:202728265-202728287 TAGGGGAGAAAGGAAGGGACAGG + Exonic
920904804 1:210152687-210152709 AAGGGCAGGATGGGAGTTTCTGG - Intronic
920910306 1:210210294-210210316 GAGGGGAAGGAGGAAGATTCTGG - Intergenic
921346968 1:214196255-214196277 TAGGGGAGGAAGGAATTGTTAGG - Intergenic
921803867 1:219432441-219432463 TAGGGGTGGGAGGAAGTCTGGGG + Intergenic
922669946 1:227501977-227501999 GAGCGGAGGCAGGAAGTATCAGG - Intergenic
922672275 1:227519677-227519699 TAGTGGAGGAAGGAGCTCTCTGG - Intergenic
922920381 1:229296757-229296779 GAGAGGAGGAAGGCAGTTTCTGG + Intronic
923397061 1:233576622-233576644 TAGAGGATGAAGGAATTTTAAGG - Intergenic
924107116 1:240659941-240659963 TAGAGGAGGAAGGAAGGCTTAGG - Intergenic
924822228 1:247504318-247504340 TAGTGGAGGAAGGAGCTCTCTGG - Intergenic
1063169949 10:3499876-3499898 AAGGGTAGGAAGGAGGGTTCTGG + Intergenic
1063228259 10:4036654-4036676 TGTGGGAGAAAGGATGTTTCAGG + Intergenic
1066402962 10:35092728-35092750 TTGGGGAGGAAGTTAGTTTATGG + Intergenic
1067088932 10:43256873-43256895 GAAGGGAGGAAGGGGGTTTCCGG - Intronic
1068243919 10:54340548-54340570 TAGGGGAAGAAGTAAGTTTAAGG + Intronic
1068550922 10:58407133-58407155 GAGGTGAGGAAGGAAGTTAGGGG - Intergenic
1069025851 10:63540538-63540560 GAAGGGAGGAAGGAAGCTTGAGG + Intronic
1069784537 10:70979242-70979264 GAGTGGAGGAATGAAGTGTCGGG - Intergenic
1070286593 10:75087936-75087958 GAGGGCAGGAAGGAGGTCTCGGG + Intergenic
1071275419 10:84049740-84049762 TAGGGGAGGAGGGGAGAATCTGG + Intergenic
1071502891 10:86216025-86216047 TAGGGGAGGAAGAGCATTTCAGG - Intronic
1071743207 10:88385809-88385831 TAGGGGAGAAGAGAAGTTACAGG + Intronic
1076194347 10:128505350-128505372 TATAGAAGGAAGGAAGGTTCTGG + Intergenic
1076383020 10:130038073-130038095 TTGTGGAGGGTGGAAGTTTCTGG - Intergenic
1076427046 10:130374223-130374245 GAGAGGAGGAAGGAGGCTTCAGG + Intergenic
1077511126 11:2963679-2963701 ATGGGGAGGAAGGAAGATACTGG + Intronic
1078090312 11:8260992-8261014 TGGGGGAGGGAGAAAGGTTCTGG - Intronic
1078159393 11:8827893-8827915 TAGTAGAGGAAGGAAGTTTGTGG - Intronic
1079301656 11:19284132-19284154 GAGGGGAGGAAGGAAGTCACTGG - Intergenic
1079709506 11:23664259-23664281 TCGGGGAGGAAGGAGGTTGTGGG - Intergenic
1079828139 11:25225232-25225254 TATGGGAGAAAGTAAGTTTAGGG + Intergenic
1081757494 11:45555029-45555051 TTGGGGAGGGGGGAAGTGTCTGG - Intergenic
1081876648 11:46413068-46413090 TGAGGTAGGAAGGAAGGTTCCGG - Intronic
1084850920 11:71939415-71939437 TAGGGGTGGAGGGAAGTTGCGGG - Intronic
1085294459 11:75423259-75423281 TAGGGGAGGCAGGGAATTGCAGG + Intronic
1086136381 11:83447066-83447088 GAGGGAAAGAAGGAAGATTCGGG + Intergenic
1086413177 11:86562811-86562833 TGGGGGAGGAAGGAGGATACTGG - Intronic
1089156750 11:116408728-116408750 GGGGGGAGGAAGGCTGTTTCTGG - Intergenic
1090627170 11:128617464-128617486 TAGGGGAGAAAGGGAGATTAGGG + Intergenic
1090650084 11:128798858-128798880 TGGGGGAGGAAGGAGGATGCTGG + Intronic
1091736397 12:2925495-2925517 TAGGGGAGCAGGGAAGTAGCTGG + Intronic
1093933477 12:24977333-24977355 TAAGGAAGAAAGGAAGTTGCAGG + Intergenic
1094057741 12:26283926-26283948 GAGGGGAGGAAGCAAGCCTCTGG - Intronic
1095102228 12:38197139-38197161 GAGTGGAGGCAGGAAGTATCAGG - Intergenic
1095764960 12:45884821-45884843 TAGGGGAGGAAGCAAGTATTTGG - Intronic
1096618324 12:52847217-52847239 AGGTGGAGGAAGGAAGGTTCTGG - Intronic
1096713095 12:53472217-53472239 TAGGACAGCAAGGCAGTTTCTGG + Intronic
1097066827 12:56326776-56326798 TAGGGGTTGAAGGAAGGCTCCGG + Exonic
1097283436 12:57860094-57860116 GAGGGGAGGAGAGAAGCTTCCGG + Intergenic
1097357565 12:58619210-58619232 CAGGGGAGGTTGGAGGTTTCTGG + Intronic
1098547899 12:71731613-71731635 GAAGGGAGGAAGGAAAGTTCTGG + Intergenic
1101519792 12:105471001-105471023 CAGGGGAGGAAGGTGGTCTCTGG + Intergenic
1102410821 12:112716744-112716766 TAGGGGAGGAAAGATGTTGGGGG + Intronic
1102858334 12:116314303-116314325 AAGGGGCAGAGGGAAGTTTCTGG + Intergenic
1102869432 12:116402088-116402110 GTGGGGAGGAAGGTAGCTTCAGG + Intergenic
1103009977 12:117450516-117450538 GAGAGGAGGATGGAAGGTTCTGG + Intronic
1103320860 12:120092268-120092290 GTGGGGAGGAAGGCATTTTCTGG + Intronic
1103763777 12:123268329-123268351 CAGAGGAGGAAGGAAGTTCAGGG + Intronic
1105447523 13:20470571-20470593 TCTGGGAGGAATGAAGTTTTGGG - Intronic
1105862889 13:24432507-24432529 AAGGGGTGGAAGGAAAGTTCTGG - Intronic
1106193372 13:27473327-27473349 TTGGGCAGGAAGGAAGTTTTGGG + Intergenic
1107150461 13:37105300-37105322 TAGGGGAGGATGGAGGCCTCCGG + Exonic
1107234379 13:38151406-38151428 TAGGGGAGCAGGGAATTTTTAGG + Intergenic
1107770698 13:43786119-43786141 TAGGCGGGGAGGAAAGTTTCCGG + Intronic
1108840729 13:54611329-54611351 ATGTGGAGGAAGGAAGTATCTGG + Intergenic
1110752425 13:79130571-79130593 AAGGGGAGGAAGGATGTTCCAGG - Intergenic
1111955319 13:94750665-94750687 TAGGGTGGGAAGGAAGGTTATGG - Intergenic
1112025944 13:95411078-95411100 TAGGAGTGGAAGGAAGCTTTGGG + Intergenic
1113288047 13:108875253-108875275 CAGGTGGGGAAGGAAGTGTCTGG + Intronic
1113817727 13:113186234-113186256 TGAGGGATGAGGGAAGTTTCTGG + Intronic
1114386928 14:22265291-22265313 GAGGGGAGTGAGGGAGTTTCAGG + Intergenic
1116992304 14:51289302-51289324 TAGGGTATGAGGGAACTTTCTGG - Intergenic
1117189919 14:53279388-53279410 TAGAGAAGGAAAGAAGTTTAAGG + Intergenic
1117464096 14:55975154-55975176 GATGGCAGTAAGGAAGTTTCAGG + Intergenic
1117492211 14:56260460-56260482 TGGGGGAGGCAGGCAGTTTCAGG + Intronic
1117684343 14:58238086-58238108 TAGGAGAGAAAGGAAGTAGCTGG + Intronic
1117852584 14:59990868-59990890 TGGGAGAAGAAGGAAGTGTCAGG - Intronic
1119113474 14:71996777-71996799 TAGGGGAGGAAGGGGGTGGCGGG + Intronic
1119762606 14:77162354-77162376 TAGGCTAGTAAGGAAGTTGCTGG + Intronic
1121007941 14:90502186-90502208 GAGGGGAGGAAGGAATGTTCAGG - Intergenic
1123506284 15:20942944-20942966 TAGGGTGGGTAGGAAGCTTCGGG + Intergenic
1123563510 15:21516648-21516670 TAGGGTGGGTAGGAAGCTTCGGG + Intergenic
1123979611 15:25588912-25588934 TAGGGGAGGTAGAAAGGTTGTGG + Intergenic
1123986300 15:25649297-25649319 TAGGGTAGGAAGGAAGCAGCAGG - Intergenic
1125131623 15:36289791-36289813 TAGGGAAAGAAGGAAGATTTGGG + Intergenic
1125936875 15:43644727-43644749 TGGGGTAGGAGGGAGGTTTCAGG - Intronic
1125949683 15:43741514-43741536 TGGGGTAGGAGGGAGGTTTCAGG - Intergenic
1126437916 15:48654727-48654749 TAGGGGAAGAAACAAGTTTAGGG - Intergenic
1127787177 15:62365869-62365891 GAGGGCAGGAAGAAAGTCTCGGG - Intergenic
1128077738 15:64838671-64838693 TAGGGGCGGAGGGAAAGTTCAGG - Intergenic
1128426033 15:67543055-67543077 TAGCGGAGGTCGGAAGGTTCTGG - Exonic
1128466878 15:67920038-67920060 TAGTGGAGAAAGAAAGTTTTAGG - Intergenic
1128750455 15:70145132-70145154 TTGGGGAAGAGGGAAGTATCTGG - Intergenic
1129479360 15:75810781-75810803 CAGGAGAGAAAGGAAGTATCAGG - Intergenic
1130054627 15:80511837-80511859 GAGAGGGCGAAGGAAGTTTCTGG + Intronic
1130095931 15:80856134-80856156 AAGGGGATGAGGGAACTTTCTGG + Intronic
1130438281 15:83924861-83924883 TAGGAGAGGCAGGAGGTTACTGG - Intronic
1130632455 15:85582512-85582534 TAGGGGAGGAAGGGAGTTTCAGG - Intronic
1130876436 15:88018496-88018518 TAGGGAAGCAAGGAAGTTAAGGG - Intronic
1131423264 15:92325241-92325263 TAGGAGAGGAAGAAAGGTACTGG + Intergenic
1202971868 15_KI270727v1_random:243785-243807 TAGGGTGGGTAGGAAGCTTCGGG + Intergenic
1132787782 16:1667584-1667606 GAGGGGAGGAGGGAAGTCTGAGG - Intronic
1134099193 16:11439691-11439713 TAAGGGAGGACAGAAGTTTCTGG - Intronic
1134904592 16:17969487-17969509 TAGGGTAGGAAGGAAGTTGTAGG - Intergenic
1136141895 16:28293361-28293383 CAGGTGGGGAAGGAAGTATCGGG + Intronic
1136470217 16:30474564-30474586 CAGGGGAGTAAGGGAGTGTCAGG - Intronic
1137022558 16:35442960-35442982 CAGGGTAGGAAGGAAGGCTCAGG + Intergenic
1137888114 16:52128263-52128285 TAGTTGAGGAAGGCTGTTTCAGG - Intergenic
1139070116 16:63370089-63370111 TAGTGGGGGAAGGAAATGTCTGG - Intergenic
1140432193 16:74913736-74913758 TAGGGGAAGAAAGTAGATTCGGG + Intronic
1140973481 16:80036335-80036357 TAGGGGAAGAAGGGGGTTTCAGG + Intergenic
1141176319 16:81721874-81721896 AAGGGGAGGAGGGAACCTTCTGG + Intergenic
1141392936 16:83679927-83679949 TAGGGGTGGATGGAGGTGTCTGG + Intronic
1142607474 17:1090130-1090152 GAGAGGGGGAAGGACGTTTCAGG + Intronic
1142745974 17:1958409-1958431 CAGGGGAGGAATGAAGTTATTGG - Intronic
1142817166 17:2435672-2435694 GTGGGGAGGAAGGAAGACTCTGG + Intronic
1143563051 17:7706352-7706374 AAGGGAAGGAAGGAGGGTTCAGG - Intronic
1143720784 17:8807611-8807633 GAAGGGAGGAATGAGGTTTCAGG + Intronic
1143900529 17:10171127-10171149 GAAGGGATGAAGGAAGTTTTAGG - Intronic
1144178001 17:12727062-12727084 CAGTGGAGGAAGGTAGTTGCGGG + Intronic
1144185323 17:12790467-12790489 TGGGAGAGGAAGGAAGGTGCTGG + Intronic
1146511081 17:33449265-33449287 GAGGGGAGGAAGGAAGCAGCTGG - Intronic
1146572923 17:33968386-33968408 AAGAGGAAGAAGGAAGCTTCAGG - Intronic
1146648651 17:34592366-34592388 ATGGGGAGGAAGCAAATTTCAGG - Intronic
1146692111 17:34883731-34883753 CAGTGGAGGCAGGAGGTTTCCGG - Intergenic
1147238969 17:39077972-39077994 TAGGGGCTGAAGGAAGTGTCAGG + Exonic
1147776702 17:42906993-42907015 GATGTGAGGAAGTAAGTTTCTGG + Intronic
1147860819 17:43521921-43521943 TAGGGCTGGAAGGAAGGTCCTGG + Intronic
1148535904 17:48438595-48438617 TAGGGCAGGGAGGAAATCTCTGG - Intergenic
1148575169 17:48705453-48705475 GAAGGGTGAAAGGAAGTTTCAGG + Intergenic
1149667517 17:58376015-58376037 GAGGGCAGGAAGGAGGTGTCTGG + Intronic
1150415551 17:64985707-64985729 GAGGGGAGGAAGAAAGTCCCTGG + Intergenic
1150796109 17:68238350-68238372 GAGGGGAGGAAGAAAGTCCCTGG - Intergenic
1151562681 17:74879010-74879032 GAGGGGAGGGAGGAAACTTCAGG - Intronic
1153234322 18:2971224-2971246 AAGAGGAGCAAGGATGTTTCAGG + Intronic
1153818179 18:8809012-8809034 AAGGAGAGAAAGGAAGTTTCAGG + Intronic
1153946455 18:10022454-10022476 GAGTGGGGGAAGGATGTTTCTGG + Intergenic
1154481118 18:14825875-14825897 TAGGGGAGAGAAGAAATTTCAGG + Intronic
1155242462 18:23876749-23876771 TTGGGGCGGCAGGAAGTTACAGG + Intronic
1155340973 18:24813820-24813842 TTTCGGAGGAAGGAAGTGTCTGG - Intergenic
1155704397 18:28790632-28790654 GAGGGGAAGAATGAAGTCTCTGG + Intergenic
1159269618 18:66131558-66131580 TGGTGGAGGAGGAAAGTTTCAGG - Intergenic
1159855913 18:73587127-73587149 CAGTGGAGGAAGGGAGTCTCAGG - Intergenic
1159935753 18:74366081-74366103 AAGAGCAGGAAGGAAGTTCCAGG - Intergenic
1159978376 18:74744575-74744597 TAGGGGAGAAAACAAGTTTGTGG + Intronic
1163576355 19:18113103-18113125 GAGGGGAGGGAGGAAGTATCTGG + Intronic
1164050252 19:21579852-21579874 TAGGGGAGAACACAAGTTTCTGG + Intergenic
1164604983 19:29591364-29591386 GAGTTGAGGAAGGAAATTTCTGG - Intergenic
1166212128 19:41313550-41313572 TTGGGGAGGAAAGAAGTCACAGG - Intronic
1167672584 19:50862003-50862025 GAGGGGAGGAGGAAAGTTCCTGG + Intronic
1167674104 19:50873989-50874011 GGGGGGAAGAAGGAAGTGTCTGG - Intronic
1167781729 19:51602737-51602759 CAGGTTAGGCAGGAAGTTTCTGG - Intergenic
925341915 2:3143605-3143627 TAGGGGAAGAAGAAAGGCTCCGG - Intergenic
925659955 2:6191629-6191651 AAGAGAAGGAAGGAAGTTCCAGG + Intergenic
926179693 2:10630739-10630761 TAGCTGAGGAAGCAAGTTTTTGG - Intronic
926481432 2:13400806-13400828 AAGAGGAGGAAGGAAATTCCAGG + Intergenic
926593212 2:14761648-14761670 TAGAGGAGAGAGGAAGTCTCAGG - Intergenic
926656985 2:15418690-15418712 GAGGTGAGGAAGGAAGATTATGG + Intronic
927013006 2:18926144-18926166 GAGGGGATGAAGGAAGTAACTGG - Intergenic
927474140 2:23399704-23399726 GAGGGCAGGAGGGAACTTTCTGG - Intronic
929524086 2:42683463-42683485 TGGGGGTGGAAGGAGGTTTCAGG + Intronic
930087318 2:47506945-47506967 TAGAGGTGGAATCAAGTTTCTGG - Intronic
930333533 2:50016882-50016904 AAGTGGAGGAAGGAAGTGCCAGG - Intronic
930918154 2:56719632-56719654 AAGGGGAGCTAGGAAGTGTCAGG + Intergenic
930954991 2:57194546-57194568 TAGGGAAAGAAGGAAGATTTGGG - Intergenic
931638595 2:64362157-64362179 AAGGGGAGGGAGGACGTTTGGGG + Intergenic
931991801 2:67797593-67797615 GAAGGGTGGAAGGAAGGTTCAGG + Intergenic
933289124 2:80417993-80418015 TAGGGGAGATAAGAAGATTCAGG - Intronic
933990105 2:87627875-87627897 GAGGGGAGGCAGGAAGATTCAGG + Intergenic
933994240 2:87656174-87656196 CGGGGGAGGGAGGAAGCTTCTGG - Intergenic
934940692 2:98499871-98499893 TAGGGGAGGGTGCAAGTGTCAGG + Intronic
935041807 2:99437458-99437480 GAGGGTAGTAAGGAAGTATCTGG - Intronic
935227595 2:101067109-101067131 TATGGGAGGAAGGTGCTTTCTGG + Intronic
935650045 2:105374275-105374297 TGGGGGAGGAAGGGAATTTCAGG + Intronic
935897398 2:107752691-107752713 TAGGGAGGGAAGAAAATTTCTGG - Intergenic
936299622 2:111294739-111294761 CGGGGGAGGGAGGAAGCTTCTGG + Intergenic
936303741 2:111322949-111322971 GAGGGGAGGCAGGAAGATTCAGG - Intergenic
936992149 2:118377539-118377561 CAGGAGAAGAAGGAAGATTCTGG - Intergenic
937856647 2:126676897-126676919 CAGGGCAGGAAAGAAGCTTCAGG - Intronic
938233434 2:129681208-129681230 TGGGGGAAGAGGGGAGTTTCAGG - Intergenic
938946831 2:136220070-136220092 TAGAGAGGGAAGGAAGGTTCTGG + Intergenic
939457480 2:142456061-142456083 AGGGTGAGGAAGGAACTTTCAGG - Intergenic
939870421 2:147520464-147520486 GAGGGCTGGGAGGAAGTTTCAGG - Intergenic
941028665 2:160486832-160486854 AAGGGGAGGAAATAAGTTTGGGG - Intronic
941669295 2:168274044-168274066 AAGGGAAGGAAGGCATTTTCTGG - Intergenic
943683220 2:190789593-190789615 CTGGGGAGGCAGGAAGTGTCAGG + Intergenic
944957049 2:204824009-204824031 AAGAGGAGGAAGGAAGTTAGGGG + Intronic
945137144 2:206641472-206641494 CAGGGGCTGAAGGAATTTTCAGG + Intergenic
945557606 2:211298664-211298686 GAGGGGAGGAGGGAGGTATCCGG + Intergenic
946567021 2:220977709-220977731 GAGGGGAGGTAGAAAGTTCCAGG - Intergenic
946942280 2:224782220-224782242 TGGGGGAGGAGGGAAGGTGCAGG - Intronic
948593286 2:239064497-239064519 AAGGGGAGGGAGGAAGGTTCTGG + Intronic
948695685 2:239732087-239732109 GAGGGGAGGAAGGAGGGTTGGGG - Intergenic
1169162816 20:3396731-3396753 TAGGTGAGGAAGAGAGTTGCAGG + Intronic
1169460498 20:5790229-5790251 TAGGGGAGGAAGGAAGTTTCAGG - Intronic
1170557924 20:17530578-17530600 AAGGGGAGGAGGGAACTTTCAGG + Intronic
1170830035 20:19832313-19832335 GTGGGGAGGAAGGAAGGTTGGGG - Intergenic
1171063865 20:21994073-21994095 TAGGTTAGGAAGCAAGTTTCTGG - Intergenic
1171164154 20:22956057-22956079 TGGGTGAGGATGGACGTTTCAGG + Intergenic
1171475214 20:25403379-25403401 TAGGGAAGGCAGGAAATTCCAGG - Intergenic
1171817748 20:29803465-29803487 GAGCGGAGGTAGGAAGTATCAGG + Intergenic
1171900489 20:30851806-30851828 GAGCGGAGGTAGGAAGTATCAGG - Intergenic
1172876963 20:38170223-38170245 TAGAGCAAGAAGGAAGTCTCTGG - Intergenic
1173077942 20:39838805-39838827 TAGGGCAGGAGGGTAGTTCCTGG - Intergenic
1175070816 20:56332377-56332399 TATGGGAGGAGGGAAATTTTAGG - Intergenic
1175112341 20:56657488-56657510 TCAGGCAGGAGGGAAGTTTCTGG + Intergenic
1177279147 21:18956574-18956596 AATGTGAGGAAGGAAGTGTCAGG - Intergenic
1177790245 21:25715108-25715130 TAGGGGAGAAAAGAGGATTCTGG - Intronic
1178480668 21:32977133-32977155 GAAGGGAGGAGGGAAGTTGCTGG - Intergenic
1178698827 21:34816697-34816719 GAGGAGAGGAAGGAACTTTCTGG + Intronic
1179565346 21:42244285-42244307 GAGGGGACGAAGGAAGTTCAGGG - Intronic
1179822186 21:43943398-43943420 GGAGGGAGGAAGGAGGTTTCTGG - Intronic
1180199924 21:46218066-46218088 TAGGGGAGGCAGGAAGTGAAGGG - Intronic
1181310599 22:21942657-21942679 TGGGGCAGGGAGGCAGTTTCCGG + Intronic
1182413822 22:30208354-30208376 TAAGTGGGCAAGGAAGTTTCTGG - Intergenic
1183730423 22:39615399-39615421 TAGGGGAGGAAGCAAGGGGCAGG + Intronic
1184694373 22:46131431-46131453 AAGGGCAGGAAGGGTGTTTCGGG + Intergenic
950398443 3:12752066-12752088 TAGTGGAGGGAGTAAGTTTAGGG - Intronic
950768025 3:15288422-15288444 TAGGGAGGGATGGAGGTTTCAGG + Intronic
952475356 3:33704079-33704101 TTGGGGAAGGAGGAAGTTTTAGG + Intronic
953372450 3:42400794-42400816 TAGGGGAAGAAGGAAGTTTGTGG + Intronic
953468575 3:43146906-43146928 AATGGGAGAAAGGAAGTCTCTGG - Intergenic
954024235 3:47769559-47769581 TGGGGGAGGATGGGATTTTCAGG - Intronic
955736352 3:62042534-62042556 TGCGGGAGGAAGAAAATTTCAGG - Intronic
955874343 3:63474322-63474344 TATGTGAGGAAGGAAGTCTTTGG + Intronic
956189398 3:66594391-66594413 AAGGGCATGAAGGACGTTTCTGG + Intergenic
956567579 3:70656273-70656295 TAGGGGAGAACTGAAATTTCTGG - Intergenic
957041080 3:75336038-75336060 TAGGGGAGGTAGGAATTTGGAGG + Intergenic
957319708 3:78613885-78613907 TGGAGGAGGAAGGATGTTACAGG - Intronic
957440322 3:80237885-80237907 TAGGGAAAGAAGAAAGTATCCGG - Intergenic
957798887 3:85049042-85049064 TAGGGGATTAAAAAAGTTTCAGG + Intronic
958732597 3:97974550-97974572 TAGGGGAGGAAGTAAGGGTGTGG + Intergenic
959084942 3:101842148-101842170 CAGGGGAGGAAGGGAGGGTCAGG + Intronic
959887712 3:111521371-111521393 TAGGAGATGAAGGAATCTTCTGG + Intronic
960570154 3:119177919-119177941 TAGGGAAGGAAGGATAATTCTGG + Intronic
964677995 3:159305062-159305084 GAGGGGATGAAGGAAGTCACAGG - Intronic
965336217 3:167432765-167432787 GAGGGGAAGAAGGAAGATTTGGG - Intergenic
965865573 3:173200623-173200645 GAGAGAAAGAAGGAAGTTTCAGG + Intergenic
967805419 3:193711172-193711194 TAGGCGAGGAGGGAATTCTCCGG + Intergenic
969222874 4:5772834-5772856 GAAGGGAGGAAGACAGTTTCAGG - Intronic
969385409 4:6843307-6843329 TAGTCCAGGAAGGAAGTTTCTGG - Intronic
969633857 4:8353836-8353858 TCAAGGAGGAAGGCAGTTTCTGG + Intergenic
969748947 4:9095810-9095832 GAGGGAAAGAAGGAAGTTTTGGG - Intergenic
974039379 4:56844771-56844793 TAGGGGCGGATGGAGGTTTCTGG - Intergenic
975665629 4:76732277-76732299 GAGGGGAGGCTGGAAGCTTCTGG + Intronic
975902896 4:79173972-79173994 TAGAGGAGGAAGGAAGGTAAAGG + Intergenic
977936341 4:102810248-102810270 TTGGGGAGGAAGGATGGTTCAGG - Intronic
977957857 4:103051121-103051143 TAGGGGAGTTGAGAAGTTTCTGG + Intronic
978681631 4:111388314-111388336 CAGGGGAAGAAGGAAATTTGAGG + Intergenic
978755883 4:112302492-112302514 AGGGGGAGGAAGGAAGTTGATGG - Intronic
981675680 4:147340204-147340226 AAGGGGAGGAGGGAAATTTAGGG + Intergenic
981706610 4:147665745-147665767 TAGACAAGGAAGGAAGTTTATGG - Intronic
985100421 4:186452822-186452844 TATGGGAGGAATTTAGTTTCTGG - Intronic
986687883 5:10289926-10289948 CTGGAGAGGAAGGAAGGTTCTGG + Intronic
986961818 5:13222123-13222145 TGGGGCGGGAAGGGAGTTTCTGG - Intergenic
987187476 5:15439530-15439552 GGGGGGATGAAGGAAGTTTATGG + Intergenic
987342829 5:16953644-16953666 TAGGGGAGGTAGGGGGTTTGGGG + Intergenic
989248841 5:39283701-39283723 TAAGGGTGGAAGGAATTCTCAGG + Intergenic
992692184 5:79251663-79251685 AAGGGTAGGAAGGAAGTTGAGGG - Intronic
992695109 5:79278379-79278401 TAGAGGAGGAAGGAAAGTGCAGG - Intronic
993393934 5:87358536-87358558 TAGGAGATGAAGGCAGATTCTGG - Intronic
993439668 5:87940178-87940200 TAAGGTAGGAAGGGAGTTACTGG - Intergenic
994197542 5:96936322-96936344 TGGGGGAGGCAGGGAGGTTCGGG + Intronic
994205845 5:97034426-97034448 TAGGGGAGGTGGGGAATTTCTGG + Exonic
994493475 5:100478549-100478571 GAGAGGAAGAAGGAGGTTTCTGG - Intergenic
995889086 5:116930260-116930282 TAGGAAAGGAAGTAAGTTTTTGG + Intergenic
997639905 5:135442345-135442367 TGGGGGAGGAAGGAAGTTTCTGG + Intergenic
998161919 5:139817787-139817809 TAGGAGAGGAAGGGAGGCTCAGG + Intronic
998308287 5:141101204-141101226 TAGGGACGGAAGGAAGTACCCGG + Exonic
998385858 5:141756774-141756796 TAGGAGGGGAGGGAAGTGTCAGG - Intergenic
998389864 5:141780455-141780477 TAGGGGAGGAAAGGAGTCTGGGG - Intergenic
999389487 5:151179906-151179928 TAGGGTGGGAGGGAACTTTCTGG - Intergenic
1003622765 6:7716008-7716030 TAGGGGAGGCAGGGAGTATATGG + Intergenic
1004720409 6:18264098-18264120 TATGGGAGGAGGCAACTTTCAGG - Intronic
1005498987 6:26413500-26413522 TAGGGGGCTTAGGAAGTTTCAGG - Exonic
1005533055 6:26727917-26727939 GAAGCGAGGAATGAAGTTTCTGG - Intergenic
1005537739 6:26773747-26773769 GAAGCGAGGAATGAAGTTTCTGG + Intergenic
1007028857 6:38607975-38607997 AAGAGGAAGAAGGAAGTTTCAGG - Intronic
1008308688 6:49937608-49937630 TAGGGGAGCAGGGAAGGTTGGGG - Intergenic
1008579909 6:52897553-52897575 TGGGGGAGGAAGGAAGATGCTGG + Intronic
1008623113 6:53291364-53291386 TAGGGGAGGAAGGAAGTGGGTGG - Intronic
1009008610 6:57816160-57816182 GAAGCGAGGAATGAAGTTTCTGG + Intergenic
1011027192 6:82881986-82882008 GACGGGAGGAAGGAAAGTTCTGG - Intergenic
1011650992 6:89506022-89506044 TAGAGTAGGAAGGTAGTTGCGGG + Intronic
1014164557 6:118208911-118208933 TTGGGGAGGAAGAATTTTTCTGG - Intronic
1014948688 6:127528459-127528481 TATGGCAGGATGGAAGATTCAGG + Intronic
1015606797 6:134965410-134965432 TAGGAAAGGAAGAAAGTTGCAGG - Intronic
1016204424 6:141454382-141454404 GAGGGAAAGAAGGAAGATTCGGG - Intergenic
1016464883 6:144315394-144315416 GAAGAGAGGAAGGAAGGTTCGGG + Intronic
1016766724 6:147802910-147802932 AAGGGCATGAAGGAATTTTCTGG + Intergenic
1016799662 6:148156025-148156047 TAGGGGAGGAAAGAACTTCCTGG - Intergenic
1017195470 6:151695528-151695550 TAGGGGAGGAGGTATGTTTAGGG - Intronic
1017564837 6:155672323-155672345 TGGGGGAGGAGGGAACTTTCTGG + Intergenic
1021981073 7:26056164-26056186 TAGGGGAGGATGGCTGGTTCAGG - Intergenic
1022116288 7:27263916-27263938 TGGGGTAGGCAGGAAGTTTGTGG - Intergenic
1022127471 7:27372284-27372306 TGAGGGAGGAAGGAAGATTGAGG + Intergenic
1023348585 7:39296631-39296653 GTGGGGAGGAAGGAGGTTCCAGG - Intronic
1023464165 7:40435330-40435352 TCTGTGAGGAAGGAAGTTTGGGG + Intronic
1024028641 7:45436121-45436143 TGGAGGGGGAAGGAAATTTCAGG + Intergenic
1024100727 7:46029934-46029956 TTGTGGAGGAAGGAAGATTGGGG + Intergenic
1025708845 7:63890057-63890079 TTGGGGAGGAAGGGAATTTGAGG + Intergenic
1026451152 7:70530718-70530740 CAGGGGAGGGGGGATGTTTCTGG + Intronic
1026674464 7:72417285-72417307 TGGGGGAGGCAGGATGTTTTTGG - Intronic
1026848224 7:73709372-73709394 TAGGTGAGGGAGGAAGTCCCTGG - Intronic
1029447419 7:100621596-100621618 TGGGTGAGGAAGGAAGACTCGGG - Intronic
1029499751 7:100921399-100921421 TTGGGGAGGAGAGGAGTTTCAGG + Intergenic
1029926767 7:104327615-104327637 TAGGGGGAGATGGAAGTTCCTGG + Intergenic
1031620420 7:123928352-123928374 TAGGGAAGGTAGGAAGCTTGAGG + Intronic
1031922737 7:127613622-127613644 TTGAGGAGGAAGGTAGTTTGGGG - Intronic
1032146240 7:129383682-129383704 TCGGGGAGGGAGGAGGTTTGGGG - Intronic
1034064382 7:148122447-148122469 CAGGGAAAAAAGGAAGTTTCAGG + Intronic
1034564215 7:151900399-151900421 AAGGCGAGGTAGGAAGTGTCAGG - Intergenic
1034961122 7:155365215-155365237 TTGGGAAGGCAGGAGGTTTCAGG + Intronic
1036024959 8:4896761-4896783 TAAGGGAAGGAGGTAGTTTCAGG + Intronic
1036576162 8:10029512-10029534 TAGGGGAAGAGGGAACTTCCAGG - Intergenic
1036933761 8:12980761-12980783 TAGAGGAGAAAGGAAATTCCAGG + Intronic
1038208245 8:25489973-25489995 TAGAGGGGGAAGGAAGTTTACGG - Intronic
1038973087 8:32659691-32659713 TAGGGAAGACAGGAAGTTTGGGG - Intronic
1040940760 8:52830487-52830509 TAAGAGATGAAGGAAGCTTCTGG - Intergenic
1041279818 8:56198390-56198412 CAGGGGAGGAAGGAGGTGACGGG + Intronic
1042263587 8:66885753-66885775 GAGGGAAGGAGGGAAATTTCTGG - Intronic
1043960849 8:86416924-86416946 CAAGGGAGGAAGGTACTTTCAGG - Intronic
1044342128 8:91058097-91058119 TAGATGAGGAAGTAAGTTTAAGG + Intergenic
1044955101 8:97471730-97471752 TAGGGCAGGGAGAAAGTTTTAGG + Intergenic
1047300609 8:123610592-123610614 TTGGTGAGGAAGGACATTTCAGG + Intergenic
1047337394 8:123949864-123949886 TATGGGAGGAAGAAGGTTTGGGG + Intronic
1047942674 8:129840658-129840680 AAGGGGAGGAAGGGAATGTCAGG + Exonic
1047958718 8:129995413-129995435 TAGGGGAAGAGGGATGTTTCTGG - Intronic
1048296061 8:133214763-133214785 TAAGGGAAGAAGGGAGTTTTTGG - Intronic
1048855100 8:138680211-138680233 TGTGGGAGGAAGGAAGTGTGGGG + Intronic
1048862054 8:138730831-138730853 TAGGAGAGGAAGGAAGCCACAGG + Intronic
1050018331 9:1259320-1259342 TAGGGGATGAGGGAGGGTTCAGG - Intergenic
1050061983 9:1718985-1719007 ATGGGAAGGAAGGAAGGTTCAGG - Intergenic
1052404242 9:28039051-28039073 AGGGGGAGGGAGGAAGTTTAGGG + Intronic
1052861251 9:33439236-33439258 AAGGGGAGGGAGGAAGTGTGAGG - Intergenic
1053336049 9:37272561-37272583 GAGGGGAGGAATGAAGTATGTGG - Intronic
1053482082 9:38423538-38423560 TAGGGGAGGAAGGGAAGTTGAGG - Intronic
1055028038 9:71743283-71743305 GAGGGGAGGAAGGGAACTTCTGG + Intronic
1055175772 9:73316025-73316047 AAGGACAGGAAGGAACTTTCAGG - Intergenic
1055617742 9:78090687-78090709 TAGGGGAGGGAGGTAGTTGGCGG + Intergenic
1056093958 9:83232305-83232327 TGGAAGAGGAAGGAAGTTTTAGG + Intergenic
1056246085 9:84696974-84696996 TAAGGGAGGAAGGCACATTCTGG + Intronic
1056708292 9:88969920-88969942 GAGGGCAGGGTGGAAGTTTCTGG + Intergenic
1057069946 9:92088761-92088783 TAGCGAAGGAACAAAGTTTCCGG + Intronic
1057730299 9:97602614-97602636 AAGGGGAGCAGGAAAGTTTCAGG - Exonic
1058132696 9:101270887-101270909 TAGGGGAGGAGGGAGCGTTCAGG - Intronic
1058706165 9:107639578-107639600 CAGGGGAGGGAGGAGGGTTCAGG - Intergenic
1060136378 9:121159263-121159285 TAGGGGAGAAAGGGAATTCCTGG - Intronic
1060295815 9:122342367-122342389 GAGTGGAGAAAGGAAGTTTAGGG - Intergenic
1060992542 9:127857183-127857205 AAGGGGAGGGAGGGAGTTTTGGG - Intergenic
1061048187 9:128178638-128178660 CAGGGGAGGAATGAAGGGTCTGG + Intronic
1062250489 9:135591432-135591454 CAGGGGAGGCAGGAACTTTTCGG + Intergenic
1186628201 X:11317837-11317859 TAGAGCAGGAAGGAATTTTAGGG + Intronic
1186842735 X:13500895-13500917 TCTGGGAGGGAGGAAGTTTAGGG - Intergenic
1187044401 X:15632155-15632177 GAGGGGAGGAAAGAAGTATCAGG + Intronic
1188100449 X:26076156-26076178 TGGGGGAGGAGGGTGGTTTCGGG - Intergenic
1189180086 X:38995738-38995760 AAAGGGAGGAAGGACATTTCAGG + Intergenic
1190103048 X:47537504-47537526 TGGGGCAGGAAGGAATCTTCTGG + Intergenic
1191167951 X:57411415-57411437 CTGGGGAGGAAGGAAGCTTGGGG + Intronic
1192696248 X:73419058-73419080 TAGGGTAGCTAGGAAGTGTCTGG - Intergenic
1194488658 X:94518854-94518876 GAGGAGAGGAAGCAAGTATCAGG + Intergenic
1194955428 X:100173731-100173753 TTGGAGAAGATGGAAGTTTCTGG - Intergenic
1195042874 X:101030306-101030328 TAGAGGAAGATGGAAGTTTTTGG - Intronic
1195471036 X:105230183-105230205 TAAGGCAGGAAGGAACTTCCAGG - Intronic
1195663875 X:107410436-107410458 GAGGAGAGGAAGCAAGTGTCTGG + Intergenic
1196934724 X:120718330-120718352 AAGGGCATGAAGGAACTTTCTGG + Intergenic
1198729003 X:139707307-139707329 TTGTGGAGGTAGAAAGTTTCTGG - Intronic
1199570082 X:149258399-149258421 TTGGATAGGAAGGTAGTTTCAGG - Intergenic
1200675211 Y:6140749-6140771 GAGGGAAAGAAGGAAGTTTTGGG - Intergenic
1200711442 Y:6488166-6488188 TAGGTGACAAAGGAAGTTTATGG + Intergenic
1201022491 Y:9673821-9673843 TAGGTGACAAAGGAAGTTTATGG - Intergenic
1201068873 Y:10126233-10126255 GAGTGGAGGTAGGAAGTGTCAGG - Intergenic
1201586320 Y:15564817-15564839 GAGAGGAGGAAGTAAGTTTTAGG + Intergenic