ID: 1169461191

View in Genome Browser
Species Human (GRCh38)
Location 20:5797141-5797163
Sequence CTACTCTTCTTGATGAAATA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 181}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169461191 Original CRISPR CTACTCTTCTTGATGAAATA AGG Intronic
900750322 1:4391592-4391614 CTACTCTTCAAGATGAGATTTGG - Intergenic
900942184 1:5806821-5806843 CTTCTCTTCTTGCTTAAAAAGGG + Intergenic
900943345 1:5815300-5815322 CTACTCCTCTTAAAGATATAGGG - Intergenic
901850907 1:12014759-12014781 CTACTTTTTGTGATTAAATAGGG - Intergenic
901973103 1:12923727-12923749 CTACTCTGCATGATGCTATAAGG - Intronic
902012077 1:13278036-13278058 CTACTCTGCATGATGCTATAAGG + Intergenic
902615676 1:17622320-17622342 CTACTCCTCTCGATGCAAGAAGG - Intronic
909954146 1:81756932-81756954 CTACTGTTATTCATGACATAAGG + Intronic
910422064 1:87076689-87076711 CAACTCTTCTAGTTGAAAAATGG + Intronic
910445328 1:87294169-87294191 CTACTCTTCATGAAGAAAAATGG + Intergenic
910893237 1:92040134-92040156 ACACTCTTCCTGATGATATAAGG + Intronic
911797039 1:102088702-102088724 CTACTCTTCTTGATGAAGGTGGG + Intergenic
911897779 1:103459769-103459791 TTACTTTTCTAGATCAAATAAGG - Intergenic
912213315 1:107578999-107579021 CTACTATTCCTGAAGGAATAAGG + Intronic
913501198 1:119474279-119474301 CTACTCTTCTAAATGAGAGATGG - Intergenic
914934949 1:151970590-151970612 CTAGTATTCTTGTTGAAATCAGG + Intergenic
916312633 1:163413777-163413799 CTACTCTTCATCATGACATCAGG + Intergenic
917327858 1:173851537-173851559 CTGCTGTTCTTGAGGAAAAAGGG - Intronic
917775383 1:178328717-178328739 GTACTCTTCTCTATAAAATAAGG - Intronic
918739171 1:188105190-188105212 GCACTCTTCTGGATGTAATAGGG - Intergenic
919188653 1:194187130-194187152 ATCCTCCTCTTGATCAAATAAGG - Intergenic
919339245 1:196282814-196282836 CAACACTTCATGATAAAATAGGG + Intronic
919409332 1:197224782-197224804 TTACAATTCTTTATGAAATATGG + Intergenic
920166826 1:204041999-204042021 CTTCTCTTGTTTATGAAATCGGG - Intergenic
924879291 1:248141538-248141560 CTCCTCTTCCAGATGTAATAAGG + Intergenic
1063770820 10:9197777-9197799 GAACTCTTCTTGCTGTAATATGG - Intergenic
1068442446 10:57075889-57075911 CAACTCTTCTAGATTAAATCAGG - Intergenic
1070142651 10:73749845-73749867 CTGCTCTTCTTGAGAAAGTAAGG - Intronic
1072561108 10:96575097-96575119 GTACTCTTCTTTAGTAAATATGG + Intronic
1072837523 10:98732033-98732055 CTATTCTTTTTGATGCAATTGGG - Intronic
1074478721 10:113798087-113798109 TTAATCTTCTAGATAAAATAAGG + Intergenic
1074936415 10:118186226-118186248 CTACTATTCAAGATGAAATTTGG - Intergenic
1078216018 11:9312518-9312540 CTTCACTTCATGATGAAGTAAGG - Intronic
1080747892 11:35125579-35125601 CTTCTTTTCTTGACAAAATAGGG - Intergenic
1081363853 11:42211937-42211959 CCACTCTTCTTACTGAAATTAGG - Intergenic
1089127552 11:116187512-116187534 TTGCTCTTCTTGATGCAGTAGGG - Intergenic
1092343662 12:7697688-7697710 CTACTCTTATTGTTGAAAAAAGG - Intergenic
1092642921 12:10536985-10537007 CTACAATTCTAGATGAAATTTGG + Intergenic
1093282016 12:17205682-17205704 CTATCCATCTTGGTGAAATAAGG + Intergenic
1094218870 12:27972549-27972571 CTGCTCTTCTGGCTGAAAGAGGG + Exonic
1094290677 12:28845598-28845620 CTACTGAGCTTGAAGAAATATGG - Intergenic
1096066880 12:48748115-48748137 CTAATTTTCTTAGTGAAATAAGG - Intergenic
1096376773 12:51118733-51118755 CGACTCTTCTTGCTTAAAAATGG + Exonic
1106815420 13:33402318-33402340 CTTCTGTTCTTGATAAAATTAGG + Intergenic
1107372334 13:39766474-39766496 CAGCTCATCTTGATGAAATTTGG - Intronic
1113650432 13:112030545-112030567 CTAACCTGCGTGATGAAATAAGG - Intergenic
1115025032 14:28734218-28734240 CTACTCTTCCTTTTGAAAGATGG - Intergenic
1115148057 14:30249751-30249773 CTTCTCTGGTTCATGAAATAAGG - Intergenic
1116725849 14:48560924-48560946 CCACTCTTCCTGATGAAAGTGGG - Intergenic
1116765196 14:49062012-49062034 CAATTTTTCTTGATGAAAGATGG + Intergenic
1121072587 14:91037988-91038010 CTATTGTTCTGGAGGAAATAGGG + Intronic
1122093534 14:99355020-99355042 CCACTCTTGTTGAAGAAAGATGG + Intergenic
1123111479 14:105869580-105869602 CAACTGTTCTTGAAGAAAAAAGG - Intergenic
1127143516 15:56001347-56001369 CTTCTCTTCTTGATCTTATAAGG - Intergenic
1127709722 15:61584423-61584445 CTAGTCTTGGTGATGAAAGATGG - Intergenic
1127765247 15:62179556-62179578 TTCCACTTATTGATGAAATAGGG - Intergenic
1128762436 15:70226425-70226447 CATGTCTTCTTTATGAAATAGGG - Intergenic
1129927611 15:79379158-79379180 CCACTCTTATTGATTAAATATGG - Intronic
1130263306 15:82376523-82376545 CTACTCTTCCTGATGAAGGTGGG + Intergenic
1130277998 15:82493143-82493165 CTACTCTTCCTGATGAAGGTGGG - Intergenic
1130470327 15:84220328-84220350 CTACTCTTCCTGATGAAGGTGGG - Intergenic
1130477815 15:84334895-84334917 CTACTCTTCCTGATGAAGGTGGG - Intergenic
1130493950 15:84453235-84453257 CTACTCTTCCTGATGAAGGTGGG + Intergenic
1130592616 15:85224956-85224978 CTACTCTTCCTGATGAAGGTGGG - Intergenic
1133205897 16:4233383-4233405 ACACTGTTCGTGATGAAATACGG + Intronic
1133854228 16:9534623-9534645 CTCCTCTCCTTGATCAGATATGG + Intergenic
1135240301 16:20800624-20800646 TTACTCTTCTTTCTGAAATAAGG - Intronic
1135738580 16:24954109-24954131 TTACTCTTCTTGTATAAATAAGG - Intronic
1140696886 16:77543510-77543532 CTACTCTTCGTGGTGTAAAAAGG - Intergenic
1144005313 17:11094320-11094342 TTACTCATCATGATGACATAAGG + Intergenic
1149400971 17:56295556-56295578 CTACTCTTCATTAAGAAATCTGG + Intronic
1151486029 17:74401015-74401037 CTACTCTGCTTGAAGACTTATGG - Intergenic
1155828264 18:30477626-30477648 CTTCTCTTCTTCAAAAAATAGGG + Intergenic
1155900656 18:31385713-31385735 CTCATCTTTTTGGTGAAATAGGG + Intronic
1158652996 18:59304396-59304418 TTCCTCTACTTGAAGAAATATGG + Intronic
1168565415 19:57418359-57418381 CCATTCTTCTTGCTGACATAGGG + Intronic
926071425 2:9896223-9896245 CTCCTCTTCTTGAAAAAAGAGGG - Intronic
926449755 2:12987936-12987958 CTGCTCTTCTTCATGGGATAAGG + Intergenic
930187180 2:48421722-48421744 ATAATGTTTTTGATGAAATAAGG - Intergenic
931359026 2:61562712-61562734 CTTCTCTTCTTTTTGAGATAGGG + Intergenic
934667259 2:96181158-96181180 CTACTGTTCTAGATGAAAAGTGG + Intergenic
935543177 2:104373508-104373530 CTACTCTTCATGAGTAAAGAGGG - Intergenic
938156178 2:128942345-128942367 CTACTGTTTTTGATTCAATAAGG + Intergenic
938851223 2:135262472-135262494 CTAGTCTTTTTGAGGTAATATGG - Intronic
939041363 2:137192699-137192721 CTACTCTTATTCCTGAAATCTGG + Intronic
939127996 2:138201268-138201290 CTACTATTCTCTATGAAAAATGG - Intergenic
940456822 2:153912431-153912453 CAACTCTTCTTGGAGAACTAGGG + Intronic
941230808 2:162910192-162910214 CTACTGTTTTTTATGGAATACGG + Intergenic
941716181 2:168765828-168765850 CTACCAATTTTGATGAAATATGG - Intronic
942575672 2:177361088-177361110 CCACTCATCATAATGAAATAAGG - Intronic
943597348 2:189874346-189874368 CTACTCCTCTTGATGAGATCAGG - Intronic
943848214 2:192679337-192679359 CTACTATTCTTTTTGAAATGAGG + Intergenic
943974670 2:194458584-194458606 CTATGCTTCTTCATGAAAGAAGG + Intergenic
944939699 2:204610284-204610306 CTGTTCTTCTTAATGTAATATGG + Intronic
1168822884 20:787662-787684 CCACTCTTCTTGATGAAGGTAGG + Intergenic
1169102824 20:2966534-2966556 CCACTATTCTTGATGAGATAGGG + Intronic
1169386401 20:5153665-5153687 CTACTCTTCTTCCTGAGATGAGG + Intronic
1169461191 20:5797141-5797163 CTACTCTTCTTGATGAAATAAGG + Intronic
1170598061 20:17820350-17820372 CTACTCTTCTTGTTGGGATGTGG - Intergenic
1172313049 20:33932850-33932872 CACCTCTTCTTGCTGAAATCAGG + Intergenic
1172947057 20:38697682-38697704 CTGCCCTTCTTGTTCAAATAGGG + Intergenic
1174473695 20:50780539-50780561 TTATTCTTCGTTATGAAATATGG - Intergenic
1177246318 21:18529320-18529342 ATCCTCTTCTTCATGACATAAGG - Intergenic
1178143801 21:29715920-29715942 CTACAATTCATGATGAGATATGG - Intronic
1178191069 21:30281793-30281815 CTACCTTTCCTGATGAAATGGGG - Exonic
1181089666 22:20464011-20464033 CTACCCTTCATGCTGAAAGATGG - Intronic
1181661147 22:24349936-24349958 CTCCTCTTCTAGAAGAAATGGGG - Intronic
1182033994 22:27183367-27183389 CTACTTTTATGGATGACATATGG - Intergenic
949198909 3:1347441-1347463 CTAAACTTATTGAGGAAATAAGG + Intronic
949272699 3:2238275-2238297 CTACTTTTCCTTATGAATTATGG + Intronic
949718612 3:6962798-6962820 TTAGTCTTCTTGATGAAACCTGG - Intronic
949761733 3:7478584-7478606 CAACAGCTCTTGATGAAATAGGG + Intronic
952470229 3:33640700-33640722 CTACTCTTTTTAAAAAAATAAGG - Intronic
955926451 3:64010300-64010322 CTACTCTTCTTTCTAAAATCGGG + Intergenic
957989330 3:87610048-87610070 CTACTCTTCCTGATGAAGGTGGG + Intergenic
958080894 3:88744782-88744804 GTACTCTGCATGGTGAAATAAGG + Intergenic
959040133 3:101412623-101412645 TAACTCTTCTTAATGGAATATGG + Intronic
959744102 3:109756599-109756621 CAACTCTCCTACATGAAATATGG + Intergenic
960004221 3:112765572-112765594 CTACTCTTCTTCTTGAAACAGGG + Intronic
961098749 3:124180396-124180418 CTACCTTTCTTGATGAAAGCTGG - Intronic
961138673 3:124536681-124536703 CAACGCTTCTTTATGATATATGG - Intronic
962589441 3:136873634-136873656 CTACAATTCAAGATGAAATATGG - Intronic
965201652 3:165666527-165666549 TCCCTCTTCTTGGTGAAATAGGG + Intergenic
973716940 4:53686149-53686171 CTAATCTTCTTAATCAAATTGGG - Intronic
974316672 4:60290898-60290920 CCACACTTCTTGATGACAGAAGG + Intergenic
974550296 4:63363394-63363416 CTGCTCTTCTAGATGAGTTATGG + Intergenic
977848490 4:101794805-101794827 TTACTCTTCATGATTAAAGAGGG - Intronic
977920605 4:102638489-102638511 CTACTCTTCCTGAGGAACTCAGG + Intronic
979016325 4:115438755-115438777 CTACACTTTTTGAAGAAACAAGG - Intergenic
979047667 4:115889409-115889431 CTAAACTCCCTGATGAAATATGG - Intergenic
980561788 4:134486810-134486832 CCACTCTTCTTCTTTAAATACGG + Intergenic
983335066 4:166380424-166380446 CTACTCTTCTTTCTGGCATATGG + Intergenic
983632217 4:169860611-169860633 ACACTCTTCTTGGTGAAACAGGG + Intergenic
986279965 5:6314827-6314849 CTGCTCTTCTTCATGAAACTCGG - Intergenic
987830373 5:23087532-23087554 CAATTCTTCATGATGATATAGGG + Intergenic
990121601 5:52460989-52461011 CTACCATTTTTGATGAAATTGGG - Intergenic
990204750 5:53416584-53416606 CTTCTCTTCTTCCTGATATATGG - Intergenic
990455352 5:55980761-55980783 TAACTCTTCTTGATGAGAAATGG + Intronic
993515205 5:88824226-88824248 CTAATCTTTTTAATGAAATTAGG + Intronic
993629193 5:90263705-90263727 CTCCTCTCCTTGATGGAAAACGG + Intergenic
996222139 5:120947272-120947294 CCTCTCTTCTTGCTCAAATATGG - Intergenic
1000733131 5:164861336-164861358 CTGCTCTTTATGAAGAAATAAGG - Intergenic
1005402989 6:25454179-25454201 CTACTTTTCTTGCTTAATTAAGG + Intronic
1008720604 6:54345626-54345648 CTCCTTTCCTTGATGAAATGGGG + Intronic
1009267336 6:61572247-61572269 CAACTCTCCTAGATTAAATAAGG + Intergenic
1010094235 6:72021119-72021141 CAACTCTTTATGATGAAATATGG - Intronic
1011225460 6:85100438-85100460 CTACTCTTCTAGATTAAACCAGG + Intergenic
1011429166 6:87266925-87266947 CTACTATTCTTGAAAAAATAGGG + Intergenic
1015006773 6:128291882-128291904 CTACTCTTGTTGTAGAAAAAGGG + Intronic
1018907473 6:168083847-168083869 CTTCTCTTTTTGATGAGATGGGG + Intergenic
1023255539 7:38309014-38309036 GCATCCTTCTTGATGAAATAAGG - Intergenic
1025734429 7:64134563-64134585 CTACAATTCATGATGAAATTTGG - Intronic
1027426876 7:78069952-78069974 GTGCTCTTCTTGATGAAGTTTGG + Intronic
1027494003 7:78864920-78864942 CTCCTCTCCTTGAAGACATAGGG - Intronic
1027701418 7:81474478-81474500 CTTCTCTTCTTCCTGCAATAGGG - Intergenic
1028423604 7:90661481-90661503 CTAGTCTTAGTGATGAAATTGGG + Intronic
1028618533 7:92798610-92798632 CCACTCTTATTGATGAATGAGGG + Intronic
1029880648 7:103806145-103806167 TTTCTCTTCTTGATTACATATGG - Intronic
1030355347 7:108535938-108535960 CTAATCTTCTGTATGATATATGG + Intronic
1031462787 7:122072196-122072218 GTTCTCTTCTTTATGAAATGAGG - Intergenic
1033026442 7:137777962-137777984 GTATTCTTGTTGAGGAAATAAGG - Intronic
1033188932 7:139258170-139258192 CTACTATTCTTAATGACAAATGG - Intronic
1037022915 8:13995987-13996009 GTACTCTTTTTGAGGAAATAGGG - Intergenic
1039676858 8:39677115-39677137 TTCCTCTTCTTAATGAAATGAGG - Intronic
1043620750 8:82189863-82189885 CTACCCCTCATAATGAAATATGG - Intergenic
1043996604 8:86825271-86825293 CTCCACTTCTTGATGAGAGATGG + Intergenic
1044811168 8:96063699-96063721 CTGGTCTTCTTGATGAAGTGAGG - Intergenic
1045123947 8:99068847-99068869 CTACAATTCTAGATGAAATTTGG + Intronic
1045623279 8:104008554-104008576 CTAATTTTCTTGAGGAAATTGGG + Intronic
1046767718 8:118088299-118088321 TAACTCTTCTTTATGAAATCGGG + Intronic
1048525614 8:135199712-135199734 CTGCTCTTCTTTAGGAAATTAGG - Intergenic
1049135832 8:140898527-140898549 CTTCTCCTCTTGAAGAAATAGGG + Intronic
1051284278 9:15479935-15479957 CTAATATTCTTGATGCGATATGG + Intronic
1052428122 9:28331339-28331361 CAACTCTACTTGATTAATTAAGG - Intronic
1052943879 9:34151740-34151762 CTTCCCTTCTTGATGAGAGAAGG - Intergenic
1055878017 9:80966314-80966336 CTTCTCTCCTGGATGAAATAAGG - Intergenic
1056896657 9:90557224-90557246 CTTCTCTCCTTGAGTAAATATGG + Intergenic
1056900077 9:90590587-90590609 CTACTGTTCTTAAAGAATTAAGG + Intergenic
1059776572 9:117481817-117481839 CTCCTCTTCCTGAAGAAATCAGG - Intergenic
1061839528 9:133349744-133349766 CTCATGTTCTGGATGAAATAAGG - Intronic
1062189579 9:135241002-135241024 ACATTCTTCTTGCTGAAATAGGG + Intergenic
1185988429 X:4863550-4863572 CTACTCATGTCGATGAAATATGG + Intergenic
1186169169 X:6858934-6858956 CTACAATTCATGATGAGATATGG - Intergenic
1187039687 X:15580420-15580442 CTATTCTACTTTATAAAATAAGG + Intronic
1188514047 X:30966019-30966041 TTACTATTCTTGATGAGATTTGG + Intronic
1189604351 X:42660598-42660620 CTACAATTCTTGATGAGATTTGG - Intergenic
1189746884 X:44177905-44177927 CTAGTCTTGTTGACGGAATAGGG - Intronic
1192070643 X:67936838-67936860 CTTGTCTTTTTGATGAAAAAGGG + Intergenic
1195120349 X:101744123-101744145 CTTCTCTTCTTGATGGGATGGGG - Intergenic
1195505405 X:105650566-105650588 CTTCTCTTCTTAAAGAAACATGG + Intronic
1195573447 X:106422698-106422720 CTCCCCTTCTGGATGAAAAATGG - Intergenic
1196374018 X:115011819-115011841 ATCCTCATCTTGGTGAAATAGGG - Intronic
1197898560 X:131343344-131343366 CTTCTCTTCTTTCAGAAATATGG + Intronic
1198996216 X:142577204-142577226 CTACAATTCATGATGAAATTTGG - Intergenic
1200709137 Y:6468282-6468304 CCACTCTTCTTGATAGAAGAGGG - Intergenic
1201024975 Y:9696427-9696449 CCACTCTTCTTGATAGAAGAGGG + Intergenic