ID: 1169465264

View in Genome Browser
Species Human (GRCh38)
Location 20:5832357-5832379
Sequence CCAAATACAAAGGTGTAACT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 3, 3: 11, 4: 125}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169465261_1169465264 -3 Left 1169465261 20:5832337-5832359 CCACTTTGATTTTCTTTACTCCA 0: 1
1: 0
2: 2
3: 47
4: 507
Right 1169465264 20:5832357-5832379 CCAAATACAAAGGTGTAACTTGG 0: 1
1: 0
2: 3
3: 11
4: 125
1169465260_1169465264 26 Left 1169465260 20:5832308-5832330 CCTCGGGCAGAGTGGAACTGCAC 0: 1
1: 0
2: 0
3: 4
4: 84
Right 1169465264 20:5832357-5832379 CCAAATACAAAGGTGTAACTTGG 0: 1
1: 0
2: 3
3: 11
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169465264 Original CRISPR CCAAATACAAAGGTGTAACT TGG Intronic
901353224 1:8617517-8617539 CAAGTCACAAAGGTGTAACTGGG + Intronic
912165488 1:107038498-107038520 CAAAATACAAAGCTGGTACTGGG + Intergenic
912673997 1:111660170-111660192 CTTAATACAGAGTTGTAACTTGG + Intronic
915897447 1:159823132-159823154 CCAAAGAGGAAGGTGTTACTAGG - Intergenic
919271909 1:195359533-195359555 ACAACTACAAAGGTGTAATTGGG + Intergenic
920824695 1:209414430-209414452 CCAAATAGAAAAGTCAAACTAGG + Intergenic
923569319 1:235100056-235100078 GCAATTAAAAAGGTGTAAATAGG + Intergenic
923632129 1:235657707-235657729 CTAAATACAAATGAGTAATTAGG - Intergenic
1065792327 10:29272355-29272377 CCAAATACACAGCAGTAAGTGGG + Intergenic
1066807441 10:39274211-39274233 CCAAAAAGAAAGGTTTAACTCGG + Intergenic
1068234191 10:54211481-54211503 AAAAATGTAAAGGTGTAACTTGG - Intronic
1070090272 10:73277887-73277909 CCAAATAAAAAGGTTTAAAAAGG + Intronic
1070698209 10:78578757-78578779 CTGACTACAAAGGTGTTACTGGG - Intergenic
1072580847 10:96739240-96739262 ACAAATACAAAAATGTAGCTAGG - Intergenic
1073998902 10:109347292-109347314 CCAAATACAAAGAAGTATTTTGG - Intergenic
1075582142 10:123627994-123628016 CCATGTACAAAGATGAAACTTGG - Intergenic
1080242121 11:30138394-30138416 CAAAATACAATGGTGGAACAGGG - Intergenic
1080690632 11:34554837-34554859 CCAAAGAGGAAGGTGTAACTTGG + Intergenic
1082093722 11:48109848-48109870 TCAATTACAAAGGATTAACTGGG - Intronic
1086900380 11:92360966-92360988 ACAAATACATATGTGTAACAAGG - Intronic
1091317128 11:134622430-134622452 CCCCATACAAAGGGATAACTGGG - Intergenic
1095555438 12:43498416-43498438 CCAAATATAAAGGGGGAAATAGG - Intronic
1100571027 12:95843044-95843066 AAAAATACAAAGGTTGAACTTGG - Intergenic
1102063066 12:109949540-109949562 CCAAATAAAAAAGTGTAGCCTGG - Intronic
1105443259 13:20432517-20432539 CAAAATACAAAGTTGGAATTTGG + Intronic
1105824374 13:24108865-24108887 GCAAATACAAATGTGTTACTAGG - Intronic
1107888587 13:44894575-44894597 GCAAATACAAAGGTCAAGCTAGG + Intergenic
1110103379 13:71637394-71637416 TCAATTACAAAGGTGCAAATAGG + Intronic
1110583098 13:77155865-77155887 CAAAAAAAACAGGTGTAACTTGG + Intronic
1110594815 13:77308603-77308625 CCAAATTCAAATGTCTACCTTGG + Intronic
1113892105 13:113741880-113741902 GCAAATAAAAAGGTTGAACTTGG - Intergenic
1115722238 14:36175779-36175801 ACAAATACAAATTTCTAACTAGG - Intergenic
1115950140 14:38712039-38712061 AAAAATATAAATGTGTAACTAGG - Intergenic
1117767668 14:59099872-59099894 ACAAAAACAAAGGCGTTACTAGG + Intergenic
1118073513 14:62271891-62271913 CAAAATACAAAGGTGTTCCAAGG + Intergenic
1118074015 14:62278848-62278870 ACAAATTCTAAGGTGTGACTGGG + Intergenic
1119347208 14:73935781-73935803 CTAAATTCAAATGTGTTACTTGG + Intronic
1121956299 14:98216701-98216723 CCAAATACAAAGGTGCTATGGGG - Intergenic
1121964065 14:98288210-98288232 CCAAATCCAAAGGTGGAATGAGG - Intergenic
1124039914 15:26092136-26092158 CCTAATTCAAGGGTGAAACTTGG - Intergenic
1126402642 15:48289036-48289058 CAAACTACAAAGGAGAAACTGGG - Intronic
1134320254 16:13156240-13156262 CCATATACATGGGTGTAACTGGG + Intronic
1135646049 16:24162896-24162918 CCAAAGACAAAGGTGTACCTGGG + Intronic
1136134257 16:28245185-28245207 CCAAAGTCCAAGGTGTAGCTGGG - Intergenic
1137520432 16:49190554-49190576 CAAAATACAAAGCTCTGACTTGG - Intergenic
1139117333 16:63972388-63972410 TCAAATTCAAAGGTTTAATTTGG - Intergenic
1139203730 16:65005220-65005242 CCCAGTACAAAGCTGTCACTGGG + Intronic
1141908140 16:87041155-87041177 CCAAACACCAAGGTGTCAATGGG - Intergenic
1143436424 17:6931296-6931318 CCAAAGACAAAGGGGTAAAATGG + Intronic
1151838321 17:76599035-76599057 GCAAATACAAAGCTGTAAGCAGG + Intergenic
1156822450 18:41389472-41389494 GCAAATACAAATGTGCAAATGGG + Intergenic
1158046400 18:53160581-53160603 CTAGATGGAAAGGTGTAACTGGG + Intronic
1158917997 18:62155681-62155703 CCAAATAAAAAGGTCTGACTGGG + Intronic
1161938572 19:7387656-7387678 CCAAAAGCAAAGATGTAGCTTGG - Intronic
1164363088 19:27540254-27540276 ATCAATACAAAGGTTTAACTCGG - Intergenic
1165168650 19:33874991-33875013 CCAACTAGAAAAGTGTGACTTGG + Intergenic
926363220 2:12109798-12109820 CCTTATACAAAGGTGGAATTTGG - Intergenic
932206801 2:69890441-69890463 TCAAAAGCAAAAGTGTAACTAGG + Intergenic
933310002 2:80648693-80648715 GCAAATACATAGGTGTAGCTTGG + Intronic
933498384 2:83080755-83080777 CTAAATAAAAAGGTATAAATGGG - Intergenic
937251537 2:120527161-120527183 ACAAACACAAAGGTGGAACCTGG - Intergenic
939680111 2:145119860-145119882 CCAAATACACAGGTATAATTTGG + Intergenic
940519379 2:154723980-154724002 CGAAATACAAATGTATAATTGGG - Intronic
944401354 2:199329696-199329718 CCAAATAGAAAGATTTAAATAGG + Intronic
945882312 2:215338894-215338916 CCAAAAATAAAGATGTAAGTTGG + Exonic
946728841 2:222689289-222689311 CCAAATATATAGTTGTGACTTGG - Exonic
947062699 2:226184522-226184544 CCACACACAAGGGTGTGACTTGG + Intergenic
1169465264 20:5832357-5832379 CCAAATACAAAGGTGTAACTTGG + Intronic
1170834543 20:19872407-19872429 CCAAATGCAAAGGTGGGAGTGGG + Intergenic
1180116295 21:45707696-45707718 CCAAATACAGAGGTATTATTAGG + Intronic
1180644340 22:17326171-17326193 CAAAATACAAAAATGTAGCTGGG + Intergenic
1180985307 22:19900825-19900847 CTAAATGCAAGGGTGTAACTGGG + Intronic
1182670846 22:31994569-31994591 CCTAATAAAAAGGGGAAACTTGG - Intergenic
1183799627 22:40151059-40151081 CCAAAGACAAAAGAGGAACTTGG + Intronic
952313533 3:32212027-32212049 AAAAATACAAAAATGTAACTGGG - Intergenic
952852152 3:37738353-37738375 CCACCTACACAGGTGTAACAGGG - Intronic
955419905 3:58725625-58725647 CCACAAACAAAGGTGAAACAGGG + Intronic
957576089 3:82010205-82010227 ACAAATGCAAAGGTATGACTAGG + Intergenic
958504864 3:94962223-94962245 CCAAATACAAATTTAAAACTAGG - Intergenic
958687081 3:97412338-97412360 CTGAATTTAAAGGTGTAACTTGG - Intronic
959344898 3:105181471-105181493 CAAAATAAAAATCTGTAACTAGG + Intergenic
960230226 3:115217414-115217436 CAAAATAAAAAGATGTAGCTCGG + Intergenic
962630600 3:137271837-137271859 ACAAATAAAAAGGTTAAACTTGG + Intergenic
962895996 3:139715298-139715320 CCAAATACAGAAGTGGTACTAGG - Intergenic
970747286 4:19314349-19314371 CCAACTACATAGGCGTGACTTGG - Intergenic
970802199 4:19986210-19986232 CAAAAGAAAGAGGTGTAACTGGG - Intergenic
971040101 4:22742377-22742399 TCATATACAAAGGTGGCACTGGG - Intergenic
972431839 4:38990464-38990486 CCAAAGACCAAGGTGTCATTGGG + Intronic
972592357 4:40499944-40499966 CCAAATACAAAGGTGTTTTAGGG - Intronic
974181683 4:58391817-58391839 CCAAGTCCAAAGCTGTAACAGGG - Intergenic
975390816 4:73815236-73815258 CAAAATATAAAGGTATAACTAGG - Intergenic
981607144 4:146551797-146551819 CTAAAAACAAAGGCATAACTCGG + Intergenic
983613352 4:169674748-169674770 CCAAAAAAAAAAGTGTACCTTGG - Intronic
985432122 4:189891518-189891540 CCAAATACAAATGTGCAAAAAGG - Intergenic
985503450 5:263641-263663 CCAAAAACAAAGGTGAAACTAGG + Intergenic
985734243 5:1568644-1568666 CCAAAAACAAAGGTGAAACTAGG - Intergenic
986892437 5:12325657-12325679 CCAAATTCAAAGATACAACTAGG + Intergenic
988953538 5:36290682-36290704 CCAACTTCAAAAGTGTAATTAGG + Intronic
990955560 5:61334760-61334782 ACAAAAAAAAAGGTATAACTAGG - Intronic
993098182 5:83505386-83505408 CCAAAAACAAAGGGGTTACAGGG + Intronic
993462888 5:88207330-88207352 CCATATACTAAGTTGTAGCTAGG + Intronic
997166402 5:131664346-131664368 ACTAATGCAAAGGTGAAACTTGG + Intronic
1004432491 6:15557606-15557628 ACAAATACAAAGGTGAAATCTGG + Intronic
1004652549 6:17624815-17624837 CCAAATACAAAGGAGGATCCTGG + Exonic
1004683572 6:17920181-17920203 CGAAATGAAAAGGTGCAACTGGG + Intronic
1005411094 6:25547658-25547680 CCAGATACAAAGTTATAACCTGG - Intronic
1006251543 6:32791340-32791362 CGAAATACAAAGCTGTCACCTGG + Intergenic
1011684273 6:89811852-89811874 GAAAATACAAAGGTGTAGCCAGG - Intronic
1011805212 6:91064083-91064105 TCAAAAACAAAGGTGAAACAAGG - Intergenic
1012416154 6:99016330-99016352 CCAAATACAGAGGAGTTATTTGG + Intergenic
1013008018 6:106092562-106092584 GCAAATACTAAGGAGGAACTTGG - Intronic
1014160283 6:118159722-118159744 TTAAAGACAAAGGTGAAACTAGG + Intronic
1015523262 6:134152122-134152144 CCAAAAAAAAAGGTGTTACAGGG - Intergenic
1016137476 6:140562531-140562553 CATAAAATAAAGGTGTAACTTGG + Intergenic
1021744998 7:23731172-23731194 CCAAATACAAATGTTTAGCCGGG - Intronic
1022267407 7:28770931-28770953 CAAAACAAAAAGGGGTAACTAGG + Intronic
1025878616 7:65510161-65510183 CCGAAAACAAAGATGTAAGTGGG + Intergenic
1033529826 7:142250659-142250681 CCAAAAGAAAAGGTGTACCTGGG + Intergenic
1034398748 7:150847556-150847578 CTATATACAAAGGTGGAGCTAGG - Intronic
1037074586 8:14698379-14698401 TTAAATACAAAAGTTTAACTTGG - Intronic
1037944498 8:22979029-22979051 CAAAACACAAAGTTGCAACTTGG - Intronic
1044308867 8:90669359-90669381 ACAAAAACAAAGCTGGAACTAGG - Intronic
1045515886 8:102860988-102861010 CTAAATACAATGTGGTAACTTGG + Intronic
1049291010 8:141801936-141801958 CCAAACACACAGGTGTTAGTAGG + Intergenic
1049603492 8:143518774-143518796 GCACATACAAACGTGCAACTGGG + Intronic
1049851359 8:144832815-144832837 CCCAATACAAATGTGGAGCTGGG - Intronic
1050763454 9:9103140-9103162 CCAAATAAAAAGTTATAACTTGG - Intronic
1050776567 9:9270087-9270109 CCATATACAAAAAGGTAACTAGG + Intronic
1051888128 9:21916144-21916166 CCAAGTACAAACTTTTAACTAGG - Intronic
1053267917 9:36729339-36729361 CCAGACACAAAGGAGGAACTTGG - Intergenic
1056192531 9:84198555-84198577 CCAAAGGCAAAGGTGTAGCAAGG + Intergenic
1058163616 9:101595789-101595811 CCAACAACAAAGATGTGACTCGG - Intronic
1188714020 X:33438647-33438669 TCATATACAAAGGTGAAAATCGG + Intergenic
1190540884 X:51477339-51477361 CTAAATGCAAAGGTGAAATTTGG - Intergenic
1193573179 X:83170423-83170445 TCAAATACAAAGTTGAAAATGGG + Intergenic
1194020589 X:88686303-88686325 CCAAAAACAAATGTGTAATAAGG + Intergenic
1195834766 X:109102154-109102176 GCAAATACTATGGTGTTACTGGG - Intergenic
1197434646 X:126411016-126411038 CAATATACAAAGTTGTAAATTGG + Intergenic
1198858038 X:141039011-141039033 ACAAATATAAAGCTGTAATTGGG - Intergenic
1198904658 X:141548359-141548381 ACAAATATAAAGCTGTAATTGGG + Intergenic