ID: 1169466196

View in Genome Browser
Species Human (GRCh38)
Location 20:5842250-5842272
Sequence TTTTATCTGAAGGTAGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 323
Summary {0: 1, 1: 0, 2: 1, 3: 33, 4: 288}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169466196_1169466199 0 Left 1169466196 20:5842250-5842272 CCTTCCTCTACCTTCAGATAAAA 0: 1
1: 0
2: 1
3: 33
4: 288
Right 1169466199 20:5842273-5842295 TTTCTGTACATCAGCCTAAGTGG 0: 1
1: 1
2: 1
3: 9
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169466196 Original CRISPR TTTTATCTGAAGGTAGAGGA AGG (reversed) Intronic
902148042 1:14420238-14420260 TTTTATGTCTAGCTAGAGGATGG - Intergenic
902373667 1:16020019-16020041 TGTGATCTGAAGGTAGAGGCAGG - Intronic
902403667 1:16171796-16171818 TGTGATCTGAAGGCAGAGGCGGG - Intergenic
902669553 1:17963406-17963428 TTTTTTTTTAAGGTAGGGGAGGG + Intergenic
905941641 1:41867817-41867839 TTCTATCTGAAGGCAGAGCCTGG + Intronic
906548253 1:46638126-46638148 TTTTATCTGAAGCTTGGGGTGGG + Intronic
908311746 1:62891133-62891155 ATTTATCTTAAGGTAGTAGATGG - Intergenic
909488341 1:76198796-76198818 TTTCATCTGTAGGTAGAGTTCGG + Intronic
910508300 1:87975740-87975762 TTATCTCTGAAGATGGAGGAAGG - Intergenic
911401157 1:97377452-97377474 TTTCATATCAAGGCAGAGGAAGG - Intronic
913400093 1:118422424-118422446 TTCTATCTGAAGGTGGAGGGTGG + Intergenic
914568640 1:148892660-148892682 TTTGATGAGAAGGAAGAGGAGGG - Intronic
916444887 1:164863142-164863164 TTGTGTCTGAAGGAAGAGAAGGG - Intronic
916548615 1:165828778-165828800 TTTTTTCTGCAGGTGGAGAAGGG + Intronic
917566072 1:176212787-176212809 TATTTTATGAAGGTATAGGAAGG + Intergenic
918874418 1:190021061-190021083 TTTTCTCTGTAGGAAGATGATGG + Intergenic
919267452 1:195288994-195289016 TTATCTCTGAAGATGGAGGAAGG + Intergenic
921209391 1:212879947-212879969 TGTTATCTGAACCTAGAGTATGG - Intronic
923631685 1:235653053-235653075 TGTTATTTGAAGGTAGTCGACGG - Intergenic
923834757 1:237598173-237598195 TTTTATCTAAAGGGAGAGATAGG + Intronic
924187658 1:241512133-241512155 TTTTTTCTGCAGGTAGCTGAAGG - Exonic
924327661 1:242911875-242911897 TTGTATCTGCAGATGGAGGAAGG - Intergenic
924937626 1:248785391-248785413 TCTTACCTGGAGGTAGAAGAAGG - Intergenic
1065113799 10:22464886-22464908 TTCTCTCTGAAGGCAGGGGATGG + Intergenic
1065170612 10:23023198-23023220 TGTTATCTGAAGGAATACGAGGG - Intronic
1066503570 10:36019100-36019122 TTTAACCTTAATGTAGAGGAAGG - Intergenic
1066646886 10:37619334-37619356 TTTTATGTGAACATGGAGGAAGG + Intergenic
1068323099 10:55445847-55445869 TCTTTTCTTAAGGTACAGGAGGG - Intronic
1068337707 10:55659065-55659087 TCTTATTTGAAGGGAGAGGAGGG - Intergenic
1071101186 10:82039656-82039678 TTTTATCTCAAGGGAGCTGATGG - Intronic
1071837391 10:89432165-89432187 TCTTCTCTGAAGGTAAAAGACGG + Exonic
1074620861 10:115119306-115119328 TTTTATCTAAAAGTAGATAATGG + Intronic
1074646888 10:115464790-115464812 TTTTTTATGAAAGTAAAGGATGG - Intronic
1074667027 10:115739444-115739466 TTTTATCTGACAGTAGGTGAAGG - Intronic
1074726526 10:116315856-116315878 TTTTATCCAAATGTAGTGGAGGG - Intergenic
1074917322 10:117970084-117970106 TTGTCTCTGAAGGAAGAAGAGGG + Intergenic
1076454477 10:130580196-130580218 TTTTAACTGAAGGCAGATGTGGG + Intergenic
1079132745 11:17757345-17757367 TCTTATCTGCAGGTATAGGCAGG + Intronic
1080142852 11:28943298-28943320 TTTTTTCTGATGGGAGAAGAGGG - Intergenic
1081105111 11:39057810-39057832 CTTTATGTGCAGGTAGAAGAGGG - Intergenic
1081431383 11:42980059-42980081 TTTTCACTAAAGGTGGAGGAGGG - Intergenic
1081444200 11:43114267-43114289 TTTTTACTGAAGTTAGAGGAGGG + Intergenic
1082200030 11:49355343-49355365 TTTTGTCTCAGGGAAGAGGATGG + Intergenic
1082895003 11:58180510-58180532 TTTTAGCTCCAGGGAGAGGAAGG + Exonic
1083091992 11:60209333-60209355 CTTGATTTGAAGGTAGAGGATGG + Intronic
1083100954 11:60305472-60305494 CTTGATTTGAAGGTAGAAGATGG - Intronic
1083955212 11:65979051-65979073 TTTAATATGAAGGTTGAGGCAGG - Exonic
1084772990 11:71356593-71356615 CTCTATTTGAAGGTAGAGGAAGG - Intergenic
1085438568 11:76534816-76534838 TATAATCTGAATATAGAGGAAGG + Intronic
1086655645 11:89350855-89350877 TTTTGTCTCAGGGAAGAGGATGG - Intronic
1087493208 11:98854658-98854680 TTTTTTCTGATGTTAGAGAAAGG - Intergenic
1090191136 11:124769722-124769744 TTTTCTCTGTAGGTATAGGTGGG - Intronic
1091467347 12:696747-696769 TTTTCTCTGAAGGCAGTGGTTGG - Intergenic
1091613669 12:2033009-2033031 TTTAAACTGAAGGTAGGGGGTGG + Intronic
1091875834 12:3932048-3932070 TTTTAACTGAAGGGTGGGGAGGG + Intergenic
1093382196 12:18506756-18506778 TTTTATATGAAGGTAGAAATAGG + Intronic
1094698434 12:32844694-32844716 TCTTATCAGAAAGTAGATGAGGG + Intronic
1095601742 12:44021260-44021282 TTCTATTTGAGGGTGGAGGATGG - Intronic
1095935896 12:47680799-47680821 TTTTATCAGCAGGTAGGGAATGG - Intronic
1096202966 12:49698992-49699014 TTTTCTTTGAAGATAGAGGAGGG - Intronic
1097737095 12:63194460-63194482 TTTTCTTTGAAGGCAGAGGAGGG + Intergenic
1100291589 12:93220181-93220203 AATTATCTGTAGGGAGAGGAGGG + Intergenic
1101081478 12:101189802-101189824 TGTGATGTGAAGGTGGAGGATGG - Intronic
1101222372 12:102654951-102654973 CTTTAGCTTAATGTAGAGGAAGG + Intergenic
1101623134 12:106410186-106410208 GTTTAACTTAAGGTGGAGGAGGG + Intronic
1103642082 12:122359660-122359682 TTCTACCTGAACATAGAGGAAGG + Intronic
1103823930 12:123720782-123720804 GTTACTCTGAAGGTAGAGGCAGG + Intronic
1103839372 12:123850257-123850279 TTTTAGCTGAAGGTTGAGTCCGG - Intronic
1105718859 13:23094192-23094214 TTATATCTGGAGACAGAGGAGGG + Intergenic
1106963556 13:35031798-35031820 TTCTATTTGAAGGTGGAGGGTGG - Intronic
1106995220 13:35472607-35472629 TTTTACCTGACAGTGGAGGAGGG + Intronic
1107165021 13:37273614-37273636 TTCTACCTAAAGGGAGAGGAAGG - Intergenic
1107334096 13:39334765-39334787 TTTTGACTAATGGTAGAGGAAGG - Intergenic
1107674900 13:42785365-42785387 TTATATGTAAAGGTAGAGTAAGG - Intronic
1108268535 13:48735880-48735902 TTTTAGCTGATGGGAGAGAATGG + Intergenic
1108268544 13:48735989-48736011 TTTTAGCTGATGGGAGAGAATGG + Intergenic
1108784432 13:53878189-53878211 GTCTATCAGAAGGTGGAGGATGG - Intergenic
1109590228 13:64469889-64469911 TGTGATCTTGAGGTAGAGGAAGG - Intergenic
1109818841 13:67624371-67624393 TTTTATCTGAAGCTAGTAGAAGG - Intergenic
1110262271 13:73499034-73499056 TTTTTTCTTAAGTTAGAAGAAGG - Intergenic
1110455073 13:75682378-75682400 TTTTGTCTGAAGTTAGGAGATGG + Intronic
1111751113 13:92333368-92333390 TTTTATCAGAACCTAGGGGAAGG + Intronic
1111776143 13:92664480-92664502 TTTTATTTGAAAGTGGAGTAGGG + Intronic
1111989962 13:95106700-95106722 TTTTATATTAAGATAAAGGAGGG + Intronic
1112138831 13:96614965-96614987 GTTTATCTGAGGGTAGAGTTTGG + Intronic
1112150752 13:96760241-96760263 TTGTATCTGAAGATTGAGGAAGG - Intronic
1112850310 13:103698079-103698101 TTTTATCTGAAGGCAAAAGAGGG - Intergenic
1113232333 13:108226550-108226572 TTTTATCTGAAGAGGGAGAAAGG + Intronic
1113472534 13:110557163-110557185 TGTTATCAGAAGCTGGAGGAGGG + Intronic
1113567997 13:111330527-111330549 TTTTATCTGTAGTCAGAGGAAGG - Intronic
1114371468 14:22093760-22093782 TTTTATTTGAAGTTCTAGGATGG - Intergenic
1115108678 14:29793372-29793394 ATTTATCTGAAGGAAGAACAGGG - Intronic
1115170449 14:30499019-30499041 TATTATCTGTAGATAGAAGATGG - Intergenic
1115450212 14:33539221-33539243 TTTTCACTGAAGGAAGAGTATGG + Intronic
1115995527 14:39191855-39191877 TTTTCCCTGAAGGGAGATGAAGG + Intergenic
1116412432 14:44640835-44640857 TTGTATGTGAAGGAGGAGGAAGG + Intergenic
1120094520 14:80373870-80373892 TTTTAGCTGAAGTAAGTGGAAGG + Intronic
1120169813 14:81236904-81236926 TTTTATATCTAAGTAGAGGATGG + Intergenic
1120654711 14:87176185-87176207 TGTTCTTTGAAGGTAGAAGATGG - Intergenic
1121760184 14:96438389-96438411 TTATATAGGAAGGTTGAGGAAGG + Intronic
1122496555 14:102160365-102160387 TATTATCTATAGTTAGAGGAAGG - Intronic
1123419233 15:20118048-20118070 TTTTCTTTGAGGGTAGAGGGTGG + Intergenic
1123446632 15:20335451-20335473 TTTTCTTTGAGGGTAGAGGGTGG - Intergenic
1123528455 15:21124591-21124613 TTTTCTTTGAGGGTAGAGGGTGG + Intergenic
1124048820 15:26176493-26176515 TTGTGTCTAATGGTAGAGGAGGG + Intergenic
1124781878 15:32643574-32643596 TTTTATCTGCAGGTTGACAATGG + Exonic
1125133919 15:36318459-36318481 TTCTTTCAGAAGATAGAGGAAGG - Intergenic
1126112277 15:45182346-45182368 TTTTATCTGTAGAAAAAGGATGG + Intronic
1126365235 15:47887190-47887212 TTTTCTCTGAATGAAGAGCATGG - Intergenic
1129386336 15:75198200-75198222 TTTTCTCTGGAGGTAGTGGGGGG + Intronic
1129950137 15:79579072-79579094 TCAAATCTGAAGGGAGAGGATGG - Intergenic
1133650808 16:7812824-7812846 TTTTAACTGAAGGTAATGGTAGG - Intergenic
1133749731 16:8715045-8715067 TGATTTCTGCAGGTAGAGGAGGG - Intronic
1134564858 16:15242707-15242729 TCCTACTTGAAGGTAGAGGATGG + Intergenic
1134737638 16:16513991-16514013 TCCTACTTGAAGGTAGAGGATGG - Intergenic
1134929867 16:18198169-18198191 TCCTACTTGAAGGTAGAGGATGG + Intergenic
1135092644 16:19531493-19531515 TTTTATCAGAAGGTAGAGTGAGG + Intronic
1135835164 16:25818860-25818882 TGATATCTGAAGACAGAGGATGG + Intronic
1136032431 16:27513540-27513562 TTAGATCTGAAGACAGAGGAAGG + Intronic
1137267597 16:46881866-46881888 TTTTTTTTGAGGGTAGAGGGGGG - Intergenic
1137840031 16:51632258-51632280 TTTTATCCAAAGGTGGATGAAGG - Intergenic
1137913507 16:52403471-52403493 TTTTAGCTATAGGAAGAGGAAGG + Intergenic
1138396694 16:56709978-56710000 CTGTAGCTGGAGGTAGAGGACGG - Intronic
1138811436 16:60154967-60154989 TTTTCTTTGGAGGTAGAGTAGGG + Intergenic
1139168281 16:64597667-64597689 TGATATGTGAAGGTAGAGGCAGG + Intergenic
1139466672 16:67157752-67157774 TTTTGTCAGAAGATGGAGGAAGG - Intronic
1139938641 16:70589390-70589412 GTCTATCTGAAGGTGGAGGGTGG - Intronic
1140767430 16:78173467-78173489 TTTTTTTTTAATGTAGAGGAAGG + Intronic
1143980488 17:10865258-10865280 TTGAATGTGAAGGAAGAGGATGG - Intergenic
1149338454 17:55662235-55662257 TTTTATCTGAACGTCCATGATGG + Intergenic
1152519480 17:80846824-80846846 ACTTATCTGAGGGTGGAGGAGGG - Intronic
1155626248 18:27838267-27838289 TTTTGTTTGAATTTAGAGGAGGG + Intergenic
1156434393 18:37111512-37111534 TTTTATTTGAAGGTTAAGTATGG - Intronic
1157147400 18:45177877-45177899 TTTTAGATGAAGGCAGAGTAAGG + Intergenic
1157312240 18:46560934-46560956 TTTTAGCTGCAAGTAGAGGAGGG - Intronic
1157518235 18:48326390-48326412 TTTTAGAAGAAGGTAGAGGCCGG - Intronic
1158103282 18:53855079-53855101 CTTTCTCTGAAGGAAGAGGAGGG - Intergenic
1158192169 18:54842745-54842767 TTTTGTCTGAAACTAGTGGATGG - Intronic
1159541840 18:69787871-69787893 TTTAGTCTAAAGGTAGAGCATGG - Intronic
1160785244 19:897368-897390 TTTTAGCCGAAGGTATCGGAGGG + Exonic
1161393596 19:4033487-4033509 GTTCATCTGCAGGTAGAAGACGG - Exonic
1164525840 19:29012998-29013020 TTTCATCTCAAGGTACAGCATGG - Intergenic
1168556834 19:57350532-57350554 GTTTATCAGAAGGTATAGGTTGG + Intergenic
1202636730 1_KI270706v1_random:50204-50226 CTTTACCTGAAGGTAAAGGTAGG - Intergenic
925197263 2:1936217-1936239 TTTAAGATGCAGGTAGAGGACGG - Intronic
925507919 2:4589665-4589687 TTTTATCTAAGGTTATAGGAAGG - Intergenic
927657314 2:24960363-24960385 TTTTGTCTCAGGGAAGAGGAAGG - Intronic
927955679 2:27205846-27205868 TGGTATATGAAGGTAGAGGATGG - Intronic
928711238 2:34008566-34008588 TTTTATCTGAAGGTAGAATGTGG - Intergenic
928870600 2:35973332-35973354 TCTTGTCTGGAGGTAGAGGTGGG - Intergenic
929123491 2:38502326-38502348 TTTTCTTTGAAGCTGGAGGAAGG - Intergenic
930902338 2:56522595-56522617 TTTTACCTTAGGGTAGAGAATGG + Intergenic
931026852 2:58119854-58119876 GTTTATATGAAGGTTGAGGGTGG + Intronic
931303110 2:61000590-61000612 TTTATTCTGAAGATGGAGGAAGG - Intronic
933143110 2:78817902-78817924 TTTTCTCTGAAGAATGAGGAAGG + Intergenic
933610036 2:84424409-84424431 TTTTATTTGAAGGTGGGGTAAGG - Intronic
934980522 2:98836093-98836115 ATTGATCTGAAGGAAGAGCAGGG - Intronic
935551274 2:104458871-104458893 TTTTTTCAGAAGATAGAAGAGGG - Intergenic
937755073 2:125527245-125527267 TTTTATCAGGGGGTAGAGGTTGG + Intergenic
938543401 2:132305238-132305260 TTGTCTCTGGAGATAGAGGATGG + Intergenic
938712449 2:133987196-133987218 TTTTCTGTAAAGGTAGAGGTAGG - Intergenic
938749443 2:134314682-134314704 TTTTAGCTGAAGAAAGAGGAAGG + Intronic
939294218 2:140238041-140238063 TGTTATCTGAAGTTAGAATAAGG - Intronic
939722082 2:145666446-145666468 ATTTATCAGGAGGAAGAGGAAGG - Intergenic
940275759 2:151938977-151938999 TTATATCTGCAGATAGAGAAAGG - Intronic
940399391 2:153229835-153229857 TTTTATAGGATGGCAGAGGAAGG + Intergenic
942373796 2:175314731-175314753 GCCTATCTGAGGGTAGAGGATGG - Intergenic
942668003 2:178342708-178342730 TTTTAAATGAAGTAAGAGGAAGG + Intronic
942861390 2:180617086-180617108 TTTCAACTGAAGGTAGAGAGAGG - Intergenic
943022501 2:182592067-182592089 TTTGATTTGAAGTCAGAGGATGG - Intergenic
943060154 2:183034682-183034704 TTGCTTCTGAAGGTAGAGGATGG - Intronic
943144493 2:184024793-184024815 TATTAGCTCAAGGTAGAGAAGGG + Intergenic
943277971 2:185892523-185892545 TATTATCTGAACCTAGAAGAGGG + Intergenic
943635377 2:190301233-190301255 CTTTATCTGCAGGGAGGGGAAGG + Intronic
945855908 2:215069681-215069703 TTTTATCTGAAGGTGGGTGGTGG - Intronic
947041415 2:225925159-225925181 TTGTATCTAAAAGTAGAAGAAGG - Intergenic
947473268 2:230416666-230416688 ACATATTTGAAGGTAGAGGAAGG - Intronic
1168917039 20:1498491-1498513 CTTTATCTAAAGGTAAAGAAAGG - Intergenic
1169466196 20:5842250-5842272 TTTTATCTGAAGGTAGAGGAAGG - Intronic
1170236720 20:14114591-14114613 TTTTATAAGAAGATTGAGGAAGG + Intronic
1170238934 20:14140993-14141015 TTTTCACTTAAGGTAGCGGAAGG - Intronic
1170843714 20:19944705-19944727 TTCCATCTGAAAGTTGAGGATGG + Intronic
1170993335 20:21326087-21326109 TTTTATCTGTAGAAAGTGGATGG - Intronic
1171261985 20:23742154-23742176 TTTTATGTGTAGCTAAAGGATGG + Intergenic
1171271089 20:23817884-23817906 TTTTATGTGTAGCTAAAGGATGG + Intergenic
1171504519 20:25623129-25623151 TTGAAGCTGAAGGTAGAGAAAGG + Intronic
1171872289 20:30538089-30538111 TTGTCTCTGGAGATAGAGGATGG + Intergenic
1172884270 20:38220993-38221015 TTCCCTCTGAAGGCAGAGGAGGG - Intronic
1173746535 20:45441738-45441760 TTGTATCTGAAGTGAGAGCAGGG + Intergenic
1174603844 20:51746169-51746191 GTCTATCTGCAGGTAGAGGGTGG + Intronic
1175454388 20:59099986-59100008 GTCTATCAGAAGGTGGAGGAAGG - Intergenic
1175989842 20:62782965-62782987 TTTGCTCTGAAGATGGAGGATGG + Intergenic
1178694868 21:34784122-34784144 TTTTATCTGAAGGGTGATAAAGG - Intergenic
1178797750 21:35760834-35760856 TATTATGAAAAGGTAGAGGAAGG - Intronic
1179879238 21:44286563-44286585 CTTCATCTGAAGGAAAAGGAGGG + Exonic
1180364139 22:11924109-11924131 CTTTACCTGAAGGTAAAGGTAGG + Intergenic
1182909132 22:33965980-33966002 TTTTATCAGCAAGTAGAAGAGGG - Intergenic
1184092566 22:42300160-42300182 TTTTATCTCAAGGCAGGGTAAGG + Intronic
1184424164 22:44399351-44399373 TTCTATCTGAAGGTGGAGGTGGG + Intergenic
1184899307 22:47434393-47434415 AGTTTTCTGAAGATAGAGGAAGG - Intergenic
949444472 3:4119144-4119166 TCTAATCTGAAGGTTGAGGAAGG - Intronic
950399325 3:12758627-12758649 TTTGAGCTGGAGGCAGAGGACGG + Intronic
950642058 3:14354731-14354753 TTTTTTCTGGAGGTGGGGGATGG - Intergenic
952122892 3:30265819-30265841 TTTGATCTCAAGTTAGAGGTAGG + Intergenic
955262734 3:57410481-57410503 GTTTATCTCAAGGAATAGGAAGG - Intronic
955430656 3:58841224-58841246 TTGTAGCTGAAGGGAGAGAAGGG + Intronic
957114871 3:76012100-76012122 TTTTATCTCTATGTAGAGGTAGG + Intronic
957367084 3:79239617-79239639 ATCTATCTGATGGGAGAGGACGG + Intronic
957904393 3:86538677-86538699 CTTTTTCTGAAGATTGAGGATGG + Intergenic
958544446 3:95523964-95523986 TTTTATCTGAAAGTATAGCCTGG - Intergenic
960444334 3:117729456-117729478 TTTCTTCTGAAGGTAAAGGTAGG + Intergenic
962898245 3:139735233-139735255 GTTTATTTGAATGAAGAGGAAGG - Intergenic
963212126 3:142704611-142704633 TTTTTTTTGTAGGTATAGGAAGG + Intronic
965529005 3:169751845-169751867 TTTTCTCTGAAGTTAGAGCCTGG - Intergenic
965769711 3:172169058-172169080 TTTTATGTCAAGGTAGGAGAGGG - Intronic
968287276 3:197516327-197516349 TTTTATTTTTAGGTAGAGAAAGG - Intronic
970435489 4:16030441-16030463 TTTTAACTGAATGTGTAGGAGGG + Intronic
971547302 4:27902571-27902593 TTTTATCTGAGGTAACAGGAAGG - Intergenic
972111344 4:35563218-35563240 GTTTATCTAAAGGTAGTGGAGGG - Intergenic
972446449 4:39148985-39149007 TTTTATCAGAAGGAAGAAAATGG - Intergenic
972869365 4:43277611-43277633 TTTTTTCTGAAGTTAGAGAAAGG + Intergenic
973719046 4:53705036-53705058 TTTTTTCTAAAGATAAAGGAAGG - Intronic
974336846 4:60558883-60558905 TTTTATCTGTAGGAAGAGGCAGG + Intergenic
974409386 4:61519783-61519805 TGTTTTATGAAGGTGGAGGAGGG - Intronic
976336416 4:83893244-83893266 TTTTAGGTGAAGGTTGAGGAAGG - Intergenic
976447263 4:85145464-85145486 TTTTATCACATGGCAGAGGAAGG - Intergenic
976666157 4:87594902-87594924 TTTTTTCTGGAGGTGGAGGAGGG + Intergenic
977879635 4:102188928-102188950 ATTTCACTGAAGGAAGAGGAAGG - Intergenic
978847538 4:113291986-113292008 TTTTAACTGAAGGTTGCAGAGGG - Intronic
978853367 4:113365280-113365302 TTTTTTCAGAAGGTAGACCATGG + Intronic
979226460 4:118291346-118291368 GTTCATGTGAAGGTAGAGGCTGG - Intronic
979924722 4:126546922-126546944 TCTTCCCAGAAGGTAGAGGAAGG - Intergenic
980535834 4:134121437-134121459 TTTTGTCTTAAGTTAGAGTAGGG + Intergenic
981070836 4:140536373-140536395 TTCTATGTGAATATAGAGGAAGG + Intronic
983454878 4:167951556-167951578 TCTTACCTGAGGGTGGAGGATGG - Intergenic
984196071 4:176659708-176659730 TGTTATTGGAAGCTAGAGGAAGG - Intergenic
984385547 4:179052390-179052412 TTTTTTCTGATGGTAGAGAAAGG + Intergenic
985426635 4:189837829-189837851 TTTTATCTGAGGGTACTGCAGGG - Intergenic
985851660 5:2392855-2392877 TTCTCTAGGAAGGTAGAGGAAGG - Intergenic
986483895 5:8216263-8216285 TTTTACCTTACAGTAGAGGAAGG - Intergenic
990049928 5:51485129-51485151 TTTTATTTGAAGGTGGGGTAGGG + Intergenic
990267853 5:54097749-54097771 TTTAAGCTTAAGGTGGAGGAAGG + Intronic
990702254 5:58486349-58486371 TTTTATCTGAAGGAATAAAAGGG + Intergenic
990721576 5:58701714-58701736 TTGGCTATGAAGGTAGAGGAAGG - Intronic
991651408 5:68858768-68858790 TTTTTTCTCAAAGGAGAGGAAGG + Intergenic
992414266 5:76537967-76537989 TTGTATTTGAGTGTAGAGGAGGG + Intronic
993818366 5:92581750-92581772 TTTTAACTGGATGTAAAGGAAGG - Intergenic
994179169 5:96744853-96744875 TTTTATGTTATGGTAGATGATGG - Intronic
995155481 5:108907249-108907271 TTTAATGAGAAGGCAGAGGAGGG - Intronic
995265544 5:110154698-110154720 TTTAATCTGAAGTAAAAGGATGG + Intergenic
996119151 5:119651527-119651549 CTTTCTCTGAAGGTTGTGGATGG + Intergenic
998478177 5:142439002-142439024 TCTTATCTGATGGAAGAGCAAGG + Intergenic
999549073 5:152664129-152664151 TTTAAGCTGAAGGAAAAGGATGG + Intergenic
1000667857 5:164021022-164021044 TATTAGCTGAAGGCAGAAGAAGG + Intergenic
1000811374 5:165865892-165865914 TTTTGTATGTAGGCAGAGGAGGG - Intergenic
1000939637 5:167344868-167344890 CTTTATCTGAAGGTGAAGGTGGG + Intronic
1003667187 6:8122233-8122255 TGTTACCAGAAGCTAGAGGAAGG - Intergenic
1003871071 6:10403991-10404013 TTTTAACTAAAGGAAGAGAATGG - Intronic
1006068297 6:31478283-31478305 TTGGATTTGAAGGTAGGGGATGG - Intergenic
1006325237 6:33348688-33348710 CTTTTTCTGAAGATTGAGGATGG - Intergenic
1006745115 6:36336274-36336296 CTTTATGTGAAGGTACATGAGGG - Intronic
1007843239 6:44733762-44733784 TTTTCTGGGAGGGTAGAGGATGG + Intergenic
1008040283 6:46790158-46790180 ATTTCTCTGAAGGTATCGGATGG - Intergenic
1008943087 6:57068818-57068840 TGTTACCAGAATGTAGAGGAAGG - Intergenic
1008946317 6:57100958-57100980 TTGTGTCTGGAGATAGAGGATGG - Intronic
1012002435 6:93669513-93669535 TGTTATCTGAAGCTATTGGAGGG - Intergenic
1013837545 6:114350367-114350389 TGTTATTTGAAGGAAGAGGAAGG - Intergenic
1014717282 6:124880558-124880580 ATGTACTTGAAGGTAGAGGATGG + Intergenic
1014920537 6:127210335-127210357 TTTTCTCTGATGGTAAAGGCCGG - Intergenic
1016238627 6:141900482-141900504 TTTTATCAGAAGGACGATGATGG + Intergenic
1016997720 6:149971990-149972012 TTTTATTTTTAGGTAGAGGTAGG + Exonic
1017986330 6:159446011-159446033 TGTGATCTGCAGGTAGTGGAAGG - Intergenic
1020535473 7:9390981-9391003 CTTGCTCTGAAGCTAGAGGACGG - Intergenic
1022257838 7:28677092-28677114 TTTTATCTTAAAATAGAAGAGGG + Intronic
1022804113 7:33804661-33804683 TTTTATCTGAAGGCAGTGGAAGG - Intergenic
1024342860 7:48284889-48284911 CTTTATATGATGGGAGAGGAGGG - Intronic
1024414584 7:49089815-49089837 ATTTATCTGCAGTTAGTGGAAGG - Intergenic
1029556191 7:101270983-101271005 ATTTATCTGAAGAAAGAGAAAGG + Intergenic
1030135127 7:106239316-106239338 TTATATCAGTAGGTAGAGGAGGG - Intergenic
1032072124 7:128814621-128814643 TTTGATCTGTTGGTAGTGGAGGG - Exonic
1032171147 7:129585568-129585590 TTTTCTCGGGAGGTATAGGAAGG - Intergenic
1033119160 7:138651806-138651828 TTGTATCTGAGGGCATAGGAAGG - Intronic
1033166742 7:139045542-139045564 GTTTATCAGGAGGGAGAGGAAGG + Exonic
1034786760 7:153933631-153933653 TTTTAACAAAAGGTAAAGGATGG - Intronic
1037399306 8:18477752-18477774 TATAATCTGAAGGAAGAGGAAGG + Intergenic
1037643880 8:20772842-20772864 TTATATGTGAAGGTAGGGGGAGG + Intergenic
1037764925 8:21766754-21766776 TTCTGTCTGAAGGGACAGGACGG - Intronic
1038083435 8:24166044-24166066 TTTTTCCTGAAGGTGGAGGGTGG + Intergenic
1041108777 8:54466811-54466833 TTTCCTCTGAGGGAAGAGGAGGG + Intergenic
1045685497 8:104707173-104707195 TTTTATCTTAAGGAAGAAGAGGG + Intronic
1049049093 8:140178656-140178678 TTCTTTCAGAAAGTAGAGGAGGG - Intronic
1050130317 9:2405879-2405901 AATTATCTGAAGGTAGAGATAGG + Intergenic
1050266244 9:3893094-3893116 TCCTATCGGAAGGTAGAGGGTGG - Intronic
1050919391 9:11182646-11182668 TTTTTTCTGAAGGTACAGAAAGG + Intergenic
1052109280 9:24560689-24560711 GTTTAATTGAAGGGAGAGGAGGG + Intergenic
1052921978 9:33978362-33978384 TTTTTTTTTAAGGTAGAGAAGGG - Intronic
1055857379 9:80706439-80706461 TTTTAACTGAAGGTATATGTGGG - Intergenic
1056945062 9:90987683-90987705 CTGTTTCTGCAGGTAGAGGAGGG - Intergenic
1057165052 9:92919151-92919173 ATCTATCTGAAGGTGGAGGGTGG - Intergenic
1058658924 9:107251037-107251059 GTTTACTTGAGGGTAGAGGAGGG + Intergenic
1060808478 9:126594417-126594439 ATTTCTCTAAAGGGAGAGGAAGG + Intergenic
1062436264 9:136547825-136547847 TCTTCTCTGCTGGTAGAGGATGG - Intergenic
1187177847 X:16912994-16913016 TTTAATCTGAAGTTTGTGGATGG + Intergenic
1187485112 X:19695731-19695753 GTATCTCTGCAGGTAGAGGAAGG - Exonic
1187604232 X:20865728-20865750 TTTTACCCAAAGGTAGTGGATGG - Intergenic
1187637502 X:21247130-21247152 TTCTAGATGAAGGCAGAGGAAGG + Intergenic
1188012162 X:25068720-25068742 TGTACTCTGAAGATAGAGGAAGG - Intergenic
1189249423 X:39588463-39588485 TTTTAACTGCAGCTTGAGGAGGG + Intergenic
1189540175 X:41979193-41979215 TTTTCTGGGAAGGTCGAGGAGGG + Intergenic
1191759096 X:64627849-64627871 TTTTGGCTTAATGTAGAGGAAGG + Intergenic
1192627779 X:72748007-72748029 TTTTATCTGAAATAAGAAGAGGG - Intergenic
1192653929 X:72972802-72972824 TTTTATCTGAAATAAGAAGAGGG + Intergenic
1192881269 X:75285912-75285934 GTTTTTGTGAAGGTAAAGGAAGG + Intronic
1192995956 X:76513511-76513533 CTTTATTTTAATGTAGAGGAAGG + Intergenic
1194894371 X:99421467-99421489 ATTTAGCTGGAGGTGGAGGAGGG + Intergenic
1195658636 X:107357037-107357059 CTTAAACTGAAGGTAGAGAAAGG + Intergenic
1196405260 X:115354900-115354922 TTTTAGCTGAAGGCAAATGATGG + Intergenic
1196679518 X:118456374-118456396 TTTTTTTTGAAGGTAGAGACTGG - Intergenic
1198890304 X:141387351-141387373 TTCTATAGGAAGGTAGAGGAAGG - Intergenic
1199544519 X:148993846-148993868 TCTTATCTCAAGGGATAGGAAGG - Exonic
1200770968 Y:7125204-7125226 CTTTATCTGAAGGTAAATGGTGG - Intergenic
1201225074 Y:11810788-11810810 TTGTATCTGCAGATGGAGGAAGG - Intergenic
1201694342 Y:16808248-16808270 TGATATCTGAGGGTAGAAGAAGG - Intergenic