ID: 1169471338

View in Genome Browser
Species Human (GRCh38)
Location 20:5888090-5888112
Sequence ATAAACCACCTGTACCAATT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169471338_1169471340 29 Left 1169471338 20:5888090-5888112 CCTAATTGGTACAGGTGGTTTAT No data
Right 1169471340 20:5888142-5888164 CCCGTGTTGCAGAGTCACTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169471338 Original CRISPR ATAAACCACCTGTACCAATT AGG (reversed) Intergenic
No off target data available for this crispr