ID: 1169475181

View in Genome Browser
Species Human (GRCh38)
Location 20:5924485-5924507
Sequence ATGAACAATAAGAGGACCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 253
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 239}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169475181_1169475186 -2 Left 1169475181 20:5924485-5924507 CCCTTGGTCCTCTTATTGTTCAT 0: 1
1: 0
2: 1
3: 12
4: 239
Right 1169475186 20:5924506-5924528 ATCACTCTCTCCCTGAGGCAGGG 0: 1
1: 0
2: 4
3: 16
4: 221
1169475181_1169475184 -7 Left 1169475181 20:5924485-5924507 CCCTTGGTCCTCTTATTGTTCAT 0: 1
1: 0
2: 1
3: 12
4: 239
Right 1169475184 20:5924501-5924523 TGTTCATCACTCTCTCCCTGAGG 0: 1
1: 0
2: 2
3: 15
4: 246
1169475181_1169475187 6 Left 1169475181 20:5924485-5924507 CCCTTGGTCCTCTTATTGTTCAT 0: 1
1: 0
2: 1
3: 12
4: 239
Right 1169475187 20:5924514-5924536 CTCCCTGAGGCAGGGAGAATAGG 0: 1
1: 0
2: 2
3: 25
4: 359
1169475181_1169475185 -3 Left 1169475181 20:5924485-5924507 CCCTTGGTCCTCTTATTGTTCAT 0: 1
1: 0
2: 1
3: 12
4: 239
Right 1169475185 20:5924505-5924527 CATCACTCTCTCCCTGAGGCAGG 0: 1
1: 0
2: 4
3: 60
4: 1024

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169475181 Original CRISPR ATGAACAATAAGAGGACCAA GGG (reversed) Intronic
902491356 1:16783762-16783784 ATGAGCCATAAGAGGAAAAATGG - Intronic
906731338 1:48083974-48083996 ATGAAGAAAAAGAGGGCGAATGG + Intergenic
907825950 1:58017117-58017139 ATGAACAATCAGTGGACTAGAGG - Intronic
909163262 1:72181973-72181995 ATGTACAATATGCGGACCAGAGG + Intronic
909448904 1:75777027-75777049 ATGAACAATAACAAAACAAAAGG + Intronic
909903621 1:81169585-81169607 ATGTACAATATGAGGACTATAGG - Intergenic
910365407 1:86459964-86459986 AGGAACAAAAAGAGGGCCAAGGG + Intergenic
911393504 1:97275955-97275977 AAGAAAAAAAAGAGGTCCAATGG - Intronic
912171165 1:107101239-107101261 AGGAACAGGAAGAGGACTAATGG + Intergenic
916348078 1:163816928-163816950 ATGAAAAGTAAGATGACAAAAGG - Intergenic
918612169 1:186505300-186505322 ATAGACAATAAGAGTAACAATGG - Intergenic
919462722 1:197897712-197897734 ATGAACAATGATAGAAGCAAAGG + Intergenic
919474964 1:198021544-198021566 ATCAACAAAAAGAGGACAAGAGG - Intergenic
921273814 1:213496996-213497018 ATGAACAATAAGATTCACAAAGG + Intergenic
921482404 1:215678157-215678179 ATGGACTATATAAGGACCAATGG - Intronic
922208012 1:223465931-223465953 TTGAAAAATAAGATGAACAATGG - Intergenic
922953522 1:229579407-229579429 GTGAACAATGAGAGGACAGAAGG - Intergenic
923529087 1:234798781-234798803 ATGAGCCATAAGAGGAAAAATGG + Intergenic
924276835 1:242397076-242397098 AGGAAAAAGAAGAGGTCCAAAGG - Intronic
1068137858 10:52968235-52968257 ATCTACAATCAGAGGAACAAAGG - Intergenic
1070847808 10:79538302-79538324 ATGCACAAGAAAAGGAGCAATGG + Intergenic
1070925971 10:80221831-80221853 ATGCACAAGAAAAGGAGCAATGG - Intergenic
1071274838 10:84044146-84044168 ATGAACAACATGAGAACCATAGG - Intergenic
1076037755 10:127215069-127215091 AAGAACAAAACGAGAACCAAAGG - Intronic
1078477762 11:11646884-11646906 AAAGACAAAAAGAGGACCAATGG + Intergenic
1078943112 11:16031726-16031748 TGGAAAAATAAGAGGAACAAGGG + Intronic
1079456640 11:20642260-20642282 ATGAACAATATCCAGACCAAGGG + Intronic
1080541892 11:33274082-33274104 ATGAACATGTAGAGAACCAAAGG - Intronic
1080796262 11:35566532-35566554 AAGGAAAATAAGAGGACCGAAGG + Intergenic
1082710477 11:56548480-56548502 ATGAACAACATGAGGACTAGGGG - Intergenic
1083201206 11:61122088-61122110 ATGAACAATAATAGGAGACAGGG + Intronic
1083360669 11:62105171-62105193 ATGAGCGGTGAGAGGACCAAGGG - Intergenic
1084200351 11:67553144-67553166 ATGATCCATAAGAGGAAAAATGG + Intergenic
1085163213 11:74368450-74368472 ATGAACTATAAGATAAGCAAAGG + Intronic
1085824023 11:79823893-79823915 AGAAGCAAGAAGAGGACCAAGGG + Intergenic
1086385871 11:86306659-86306681 ATGAACAACAAGAGGAGCCCAGG - Intronic
1086553971 11:88087780-88087802 GTGAACAATGAGAGTACCTAGGG + Intergenic
1086576679 11:88346665-88346687 GTGAACAACTAGAGGATCAAAGG - Intergenic
1086604128 11:88674586-88674608 TTGAACAATTAGAGGAACAATGG - Intronic
1090301270 11:125642017-125642039 AAGAACAACAATATGACCAAGGG - Intronic
1091505528 12:1063775-1063797 ATAAACAATGAGAGGAAAAAAGG - Intronic
1093320988 12:17715036-17715058 ATCAATAATAAGAGGAGCTATGG - Intergenic
1095512234 12:42964963-42964985 ATAAACAATGTGGGGACCAAAGG - Intergenic
1096890460 12:54765316-54765338 GTGAACAATCAGAGAAGCAAGGG + Intergenic
1098664148 12:73139313-73139335 ATGTACAAATAGAGGACCATGGG + Intergenic
1099727181 12:86447018-86447040 ATGAACAATACGAAGGCTAAGGG + Intronic
1101337831 12:103811943-103811965 ATGAACAATCAGGTGATCAATGG + Intronic
1102412703 12:112734048-112734070 ATGAAAAAAACGAGGTCCAAAGG + Intronic
1103089464 12:118087349-118087371 ATGGACAAGCAGAGGACCAAGGG + Intronic
1106464053 13:29996922-29996944 AAGAAGAAGAAGAAGACCAAGGG + Intergenic
1106924282 13:34597385-34597407 AGGAGCAATAATAAGACCAATGG + Intergenic
1107703148 13:43070164-43070186 ATGAATAATGACAGCACCAAAGG + Intronic
1108862964 13:54884835-54884857 ATGAGCAATAAGGGGAGCTAGGG - Intergenic
1109523313 13:63541773-63541795 ATCAAGAATAAAAGGACAAATGG + Intergenic
1110008267 13:70298291-70298313 ACAAACAATAATAGGACAAAAGG + Intergenic
1110775356 13:79403028-79403050 AGGAACATACAGAGGACCAAGGG - Intronic
1111940990 13:94606593-94606615 CTGAATAATAAGAGGAAAAAGGG - Intronic
1112964730 13:105174773-105174795 ATGAACAACAAGATGTCAAAGGG + Intergenic
1116091369 14:40311178-40311200 AGGAACAATAAGAAACCCAAGGG + Intergenic
1116957474 14:50939393-50939415 ATGAACAAGAAGACTACCTAAGG + Intronic
1117183901 14:53219821-53219843 ATAAATAAAAAGAGGAGCAATGG - Intergenic
1117248592 14:53912430-53912452 ATGTATAAAGAGAGGACCAAAGG + Intergenic
1118134912 14:63012943-63012965 AATAACCATAAGAGGAACAAGGG + Intronic
1120435701 14:84479382-84479404 ATGAACAATTAGAGTACAAGTGG + Intergenic
1121712529 14:96050098-96050120 ATGAACCATATGAGGAGAAAAGG - Intronic
1121757709 14:96416984-96417006 GTGAACCATAAGAGAACCATAGG - Intronic
1126139401 15:45424920-45424942 ATTAATTATAAGAGGACCCAAGG - Intergenic
1126443338 15:48715585-48715607 ATGTATAATAAGAGGCCCAGAGG - Intronic
1127482757 15:59392295-59392317 ATGAGTAAAAGGAGGACCAAGGG + Intronic
1129147278 15:73660023-73660045 AGGAACAAGAAGAAGAACAAAGG - Intergenic
1129829182 15:78656851-78656873 ATGTAGAATAAGAGGGCCCAGGG - Intronic
1129946300 15:79541988-79542010 ATGAACAATACAAGGACTCAGGG + Intergenic
1131961358 15:97793168-97793190 AAAAACAAGAAGAGGTCCAAGGG + Intergenic
1135911674 16:26567043-26567065 ATGAGCATCAAGAGGTCCAAAGG + Intergenic
1138784051 16:59824948-59824970 ATGAACAAATAAATGACCAAAGG - Intergenic
1139099684 16:63750347-63750369 ATGGGCATTAAGAGGAACAATGG - Intergenic
1139288911 16:65839722-65839744 ATGGTAAATGAGAGGACCAAGGG - Intergenic
1139916604 16:70432206-70432228 ATGTACAATAAGGTGAACAAGGG - Intronic
1140382417 16:74502102-74502124 ATGAACAAATAGAGGGCAAAGGG + Intronic
1143977080 17:10837807-10837829 ATGAACAACAAGCGGAGAAAAGG - Intronic
1148580828 17:48742584-48742606 AAGAGCAATGAGGGGACCAAAGG - Intergenic
1149008581 17:51831543-51831565 ATGACCAATAAGACTATCAATGG + Intronic
1154368537 18:13734202-13734224 ATAAACAAAAAGAGGTTCAATGG - Intronic
1155244103 18:23890955-23890977 AAGAACAGTAAAGGGACCAAGGG + Intronic
1155882141 18:31162749-31162771 ATAAACAGTAGGAGGAGCAACGG + Exonic
1157014824 18:43699568-43699590 CTGAACAATGAGAGGAGAAAAGG - Intergenic
1157793940 18:50558564-50558586 AGGAAGAATAAGAGGCCCCAAGG - Intergenic
1158748028 18:60224887-60224909 ATAAACAATAAGAGAAAGAAAGG - Intergenic
1159518502 18:69488519-69488541 ATAAAGAAAAAGAGGGCCAATGG + Intronic
1160382013 18:78466961-78466983 ATAAATAATAAGAGGAAGAAAGG - Intergenic
1165846444 19:38820952-38820974 ATGAACAAGAGGAGGAACAGAGG + Intronic
1166422253 19:42646983-42647005 ATGACAAATAAGAGGTACAAAGG - Intronic
1167716450 19:51145215-51145237 ATGGAAGATAAGAGGCCCAAAGG - Intronic
1168371621 19:55839178-55839200 TTGAACAATAAGAACACAAACGG - Intronic
1168388190 19:55983671-55983693 ATCACCAATAAGAAGACAAATGG + Intronic
925427750 2:3764609-3764631 ATGAAGAAAAAGAGGTTCAATGG - Intronic
925629586 2:5876954-5876976 ATGAACAATCGCAGGACCTAGGG + Intergenic
927343897 2:22014206-22014228 ATGAACATCAAGAAGACCATTGG + Intergenic
928023300 2:27720710-27720732 AAGAAGAATAAAATGACCAATGG - Intergenic
928398101 2:30958560-30958582 ATGAAAAATCAGAGCACCAACGG + Intronic
928467059 2:31532091-31532113 GTGATGAATAAGAGGACCACAGG + Intronic
928994625 2:37274327-37274349 ATGAACATTAAAAGGAACAAAGG + Intronic
929374228 2:41265457-41265479 ATGAAAAATAAGAAGCTCAAAGG - Intergenic
930010750 2:46936799-46936821 ATGAAAAAAAAGAAGACCACTGG - Intronic
930645562 2:53903095-53903117 GAGAATAAGAAGAGGACCAAGGG - Intronic
931947114 2:67322555-67322577 ATGAAAGATAAGAGGAATAAAGG - Intergenic
932028109 2:68156151-68156173 ATGAACAATACAAGGAACGAAGG + Intronic
933466439 2:82658053-82658075 ATGGACAACAAGAGGAGCAGAGG + Intergenic
933567094 2:83963404-83963426 ATGCATAATAAGAATACCAAAGG - Intergenic
934917245 2:98310167-98310189 ATAAAGAACAAGAGGACCCATGG - Intronic
935432671 2:102993181-102993203 AGGGGCAATATGAGGACCAAGGG + Intergenic
936405227 2:112196811-112196833 ATAAAGAAAAAGAGGTCCAATGG + Intergenic
937074358 2:119090206-119090228 ATGAACAAGATGAGAACTAAGGG + Intergenic
937511386 2:122599082-122599104 GTGAACCTTCAGAGGACCAATGG - Intergenic
940882983 2:158965502-158965524 AGGAAGAATGAGTGGACCAAAGG + Intergenic
941297562 2:163759221-163759243 GTGAACAGTAACAGGACCAACGG - Intergenic
942231906 2:173868001-173868023 ATAAACAGTCAGAGGACCACTGG + Intergenic
946004294 2:216509951-216509973 ATGAGAAACAAGAGTACCAAAGG - Intronic
946681483 2:222221622-222221644 ATGAACCTTATGAGGACCATGGG + Intronic
947130246 2:226915356-226915378 ATGGACAATAAGAGAAGAAAGGG + Intronic
947894974 2:233662424-233662446 ATGAACATTAAGAGTTTCAACGG - Intronic
947974433 2:234352868-234352890 ATGAACAATAAAATGATAAAAGG - Intergenic
948116925 2:235500210-235500232 ATCAATATTAAGAGGACAAATGG + Intronic
948355093 2:237371666-237371688 ATGAAAAATAACAGGCTCAAAGG - Intronic
948367962 2:237470792-237470814 ATCAACATTCAGAGGACCAAAGG + Intergenic
1169475181 20:5924485-5924507 ATGAACAATAAGAGGACCAAGGG - Intronic
1170708209 20:18765256-18765278 AGGAACAAAAATAGGAGCAATGG + Intergenic
1174612296 20:51808124-51808146 ATGAATAAACAGAGGTCCAAAGG - Intergenic
1174734317 20:52950809-52950831 TTGAAGAATAAGAGGACATATGG + Intergenic
1175471915 20:59236288-59236310 ATGAAATATAAGAGGACAAAAGG - Intronic
1175690496 20:61062311-61062333 ATTAAAAATTAGAGGACAAAGGG - Intergenic
1177730546 21:25023230-25023252 ATGCACATTAAGAGGAAAAATGG - Intergenic
1178871158 21:36377706-36377728 ATGAAGAATTTGAGGCCCAAAGG - Intronic
1179254864 21:39706887-39706909 ATGCACAATAAGAGGAAAAATGG - Intergenic
1181235328 22:21445001-21445023 CTGAACCAGCAGAGGACCAAGGG + Exonic
1183128807 22:35812614-35812636 AAACACAATAAGAGCACCAAAGG + Intronic
1185144774 22:49126047-49126069 AAGAAGAAAAAAAGGACCAAAGG + Intergenic
949978923 3:9487628-9487650 ATGAACAGGTAGAGCACCAATGG + Intergenic
952333338 3:32384642-32384664 ATGAACACTGTGAGGATCAAAGG - Intergenic
953859011 3:46526440-46526462 TTGAATAAGAAGAGGACCACTGG - Intronic
956108636 3:65848426-65848448 TTGAACAATAATAGGTCCATGGG - Intronic
956831781 3:73057101-73057123 ATGAACTAGAAGAGGAGCTAAGG + Intronic
957261516 3:77908020-77908042 ATGAACAAAAAGAGGTTTAATGG - Intergenic
957799941 3:85064594-85064616 ATGAACAAAATAAGAACCAAAGG - Intronic
957884970 3:86275152-86275174 AAGTAGAATAAGAGGCCCAAAGG + Intergenic
958524315 3:95234972-95234994 AAGAAAAATAAGAAGACAAAAGG + Intergenic
958604509 3:96340011-96340033 ATGAACAAAAAGAGGTTTAATGG - Intergenic
958787016 3:98607589-98607611 AAGAAAAATAAGATGAACAATGG + Intergenic
960748918 3:120924635-120924657 ATTACCAACAACAGGACCAATGG - Intronic
961002327 3:123382374-123382396 ATGAAAAATAAGATTACCATAGG + Intronic
961762458 3:129181749-129181771 ATGAAAAAAAAGAGGACCTTTGG + Intronic
964413597 3:156424902-156424924 ATGAAAAATAAGAGGAAACAAGG + Intronic
967961504 3:194928906-194928928 ATGCGCACTAAGAGGAACAATGG + Intergenic
969716152 4:8869229-8869251 AGGAACAAGAAGAGGCCCACAGG + Intronic
970647288 4:18136878-18136900 AGTGACAAGAAGAGGACCAAGGG + Intergenic
970783195 4:19764685-19764707 ATCAATAATAAGAGGAACACTGG - Intergenic
970960800 4:21869249-21869271 AGGAGCTATAAGAGGACCACAGG - Intronic
971718551 4:30214300-30214322 ATGAAAAATCATAGGATCAAAGG + Intergenic
972415461 4:38835033-38835055 ATAAACAATGAGAGGAAGAAAGG + Intronic
972986448 4:44771864-44771886 ATGAACACTAAGAGGAAAAATGG + Intergenic
973600405 4:52537132-52537154 ATGAGCAAGAAGATGAGCAATGG + Intergenic
974507306 4:62792344-62792366 ATGAACAAGATGAAGAGCAAAGG + Intergenic
974955165 4:68630531-68630553 ATGCACATTAAGAGGCCAAATGG + Intronic
975020887 4:69486770-69486792 ATTAACAATGAGAAGAACAAGGG + Intronic
975448300 4:74493912-74493934 ATGAACAACATGAGGACTATAGG - Intergenic
976499422 4:85770389-85770411 GTGAACAATAGGAGGACTATTGG - Intronic
978262063 4:106772181-106772203 ATAAACAAGAAGAGGACTTATGG - Intergenic
978286108 4:107078996-107079018 ATTAACAATAAGACAAACAAAGG + Intronic
979565356 4:122148617-122148639 ATGGAAAATAAGAGGACCAAGGG + Intergenic
979872630 4:125844093-125844115 AGGAACAGTAGGAGGAACAATGG - Intergenic
981827743 4:148963141-148963163 ATTAACCACAAAAGGACCAAAGG - Intergenic
982614784 4:157626983-157627005 AATAAAAATAAGAGGACCTAAGG - Intergenic
982922641 4:161294508-161294530 ATGCACACTAAGAGGCACAATGG + Intergenic
983250199 4:165335374-165335396 ATAAAAAATAGGAGGGCCAAAGG + Intronic
983531301 4:168812398-168812420 ATTACCCATAAGAGGCCCAAGGG - Intronic
985351251 4:189064536-189064558 ATGAATAATAAGAGGAACTTTGG + Intergenic
986378243 5:7155614-7155636 AAGAACAATAAAAAGAGCAAAGG - Intergenic
986537013 5:8798824-8798846 ATGAACAAAAAGAAAACAAAAGG + Intergenic
988448563 5:31315829-31315851 ATGAACCACCAGAAGACCAAAGG - Intronic
989455536 5:41639242-41639264 ATAAAAAATAAGTGGACTAATGG - Intergenic
992480786 5:77150691-77150713 ATCAGATATAAGAGGACCAAAGG + Intergenic
994276289 5:97842473-97842495 TTGAACACTAAGAGAACCGAAGG - Intergenic
994735681 5:103552095-103552117 ATGCATAATGAGAGGGCCAAAGG + Intronic
996172075 5:120305980-120306002 AGGAAAAATAAAAGGACAAAGGG - Intergenic
996947410 5:129087052-129087074 ATAAACTATAAGATCACCAAAGG - Intergenic
998037985 5:138932724-138932746 CTGAACAAAAAGAGGGCCAGTGG + Intronic
999612852 5:153389277-153389299 ATTAACAGTAAAAAGACCAATGG - Intergenic
999990617 5:157046762-157046784 TTAAACAAAAAGAGGCCCAAGGG - Intronic
1000765219 5:165280756-165280778 ATGAACACTTAGAGCACAAATGG + Intergenic
1001791272 5:174459656-174459678 ATGAAGAATAAGAGGGGCATGGG + Intergenic
1004064533 6:12230024-12230046 ATGAAAAGTAAGAGGACCTGGGG - Intergenic
1005390177 6:25324895-25324917 GTGAACCCTAAGAGGACCACTGG + Intronic
1006722732 6:36169090-36169112 AGGGACAATATCAGGACCAAAGG - Intergenic
1008790669 6:55228163-55228185 ACGAATAATGATAGGACCAAGGG + Intronic
1009031379 6:58062834-58062856 ATGAATCATCAGAGGGCCAAGGG - Intergenic
1009207230 6:60817287-60817309 ATGAATCATCAGAGGGCCAAGGG - Intergenic
1012176334 6:96090076-96090098 TTGAACAATACAAGTACCAATGG + Intronic
1012765237 6:103358450-103358472 AAAAACAATAAGAGAACCAAAGG + Intergenic
1013813186 6:114067250-114067272 ATAAATAATTACAGGACCAAAGG + Intronic
1014216253 6:118755248-118755270 AGGAGCAAAAAGAGGAACAATGG - Intergenic
1014289301 6:119539835-119539857 ATGGACAACAGGAGGACCAGTGG + Intergenic
1014457196 6:121649541-121649563 ATGAAGAATGAGAAGACCACAGG + Intergenic
1015294548 6:131575744-131575766 CTGAACAATTAGAGGTCTAAAGG - Intronic
1015668607 6:135661017-135661039 ATAAATAATAAGAGGACCATGGG + Intergenic
1016363268 6:143290542-143290564 ATGCACACTAAGAGGAAAAATGG - Intronic
1022146811 7:27551847-27551869 GAGATCAAGAAGAGGACCAATGG + Intronic
1023372232 7:39522999-39523021 ACTAAAAATAACAGGACCAATGG - Intergenic
1023469765 7:40503561-40503583 ATGACAAATAAGAGGAGAAAGGG + Intronic
1026364377 7:69633033-69633055 ATGTACAACATGAGGACTAAAGG - Intronic
1030375452 7:108748110-108748132 TTGACCAATATGAGAACCAAGGG + Intergenic
1035318850 7:158015304-158015326 ATGAACAATCAGAGAACAAGTGG - Intronic
1037179715 8:15991114-15991136 ATAAACAATGAGAGGAAAAAAGG - Intergenic
1037247544 8:16853333-16853355 AGGAAGAAAAAGAGGAACAAAGG + Intergenic
1039662541 8:39482875-39482897 ATGAACAAAAAGGGGAAAAAGGG - Intergenic
1040682327 8:49827397-49827419 ATAAACAACAAGACGAACAAAGG + Intergenic
1040715303 8:50244428-50244450 ATGAATAACAAGAGGATCTAAGG - Intronic
1041393831 8:57372367-57372389 ATGCACACTAAGAGGAAAAATGG + Intergenic
1041914409 8:63125540-63125562 ATGAAAAATAAGAATACCCAAGG - Intergenic
1044418989 8:91969649-91969671 ATGAATAACAAGGGGACAAAAGG - Intronic
1046050772 8:109019686-109019708 ATGAACGATAAGAAGACCTGGGG + Intergenic
1046845127 8:118907010-118907032 ATGAAGAAAAAGAGGATTAATGG - Intergenic
1047707410 8:127513637-127513659 ATGAACAATAAGAACACTACTGG + Intergenic
1050601273 9:7254144-7254166 ATGAATAAAAAGTGGGCCAAAGG - Intergenic
1050712236 9:8478112-8478134 ATGAGTAAAATGAGGACCAATGG - Intronic
1051318442 9:15870230-15870252 ATGAAAAATAAAAGGAAGAAAGG + Intronic
1051436606 9:17040323-17040345 ATGAACAACATGAGGACTACAGG - Intergenic
1052308810 9:27041575-27041597 ATCAACAATGAGGAGACCAAGGG - Intronic
1053413678 9:37932474-37932496 ATGCACAACACGAGGACCACAGG + Intronic
1054977665 9:71166712-71166734 AGGAAGAATAAAAGGACTAATGG + Intronic
1056338568 9:85601621-85601643 ATGAGCAATGAGAGGATCAGTGG - Intronic
1056724485 9:89102174-89102196 ATGACCAATATCAGGAACAAAGG - Intronic
1056739708 9:89243857-89243879 ATGTACAATAAGAGGCAAAATGG - Intergenic
1057214609 9:93220898-93220920 AAGATAAAGAAGAGGACCAAAGG - Intronic
1057267532 9:93629301-93629323 ATGAACACAAAGAGTATCAAAGG - Intronic
1059504937 9:114790079-114790101 TTGAACAATAACTGGACCACTGG + Exonic
1060006893 9:120008233-120008255 AGGAACAAGGAGAGGACAAAGGG - Intergenic
1060737274 9:126074052-126074074 ATGGACAATAAGAGTAGCTATGG + Intergenic
1186569187 X:10696160-10696182 ATGCACACTAAGAGGAAAAATGG + Intronic
1186570713 X:10712344-10712366 ATGTACAATAAGAGGCAAAATGG + Intronic
1187159674 X:16752734-16752756 ATGAACAGTAATGGGACAAATGG - Intronic
1190855181 X:54287253-54287275 TAGAACAATAAGAGAACCATAGG + Intronic
1192539918 X:71959090-71959112 ATGAAGAATAAGTTGATCAAGGG + Intergenic
1192602763 X:72482084-72482106 TTGAATAAAATGAGGACCAAGGG - Intronic
1192958592 X:76102249-76102271 ATAAATAATAAGAGGAACACTGG - Intergenic
1193322677 X:80141576-80141598 ATGAACAACAAGAAGAAAAAAGG - Intergenic
1198617025 X:138469695-138469717 ATGACCAAGATGAGTACCAATGG + Intergenic
1198785460 X:140283319-140283341 GGGGACAGTAAGAGGACCAAGGG - Intergenic
1199350395 X:146794067-146794089 ATGAACAAAAAGAGGTTTAATGG - Intergenic
1199569072 X:149249228-149249250 ATGAAAAATAAAAGGATGAAAGG - Intergenic
1199730988 X:150632014-150632036 AAGAAAAAGAAGAGGAACAAGGG - Intronic
1200777860 Y:7185743-7185765 ATAAAGAAAAAGAGGACTAATGG - Intergenic
1201864481 Y:18634507-18634529 ACGAAGAAAAAGAGTACCAAGGG + Intergenic
1201868841 Y:18685871-18685893 ACGAAGAAAAAGAGTACCAAGGG - Intergenic