ID: 1169475256

View in Genome Browser
Species Human (GRCh38)
Location 20:5925125-5925147
Sequence TCTGCCCTTGGGTAGATAAA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 175}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169475256_1169475259 17 Left 1169475256 20:5925125-5925147 CCATTTATCTACCCAAGGGCAGA 0: 1
1: 0
2: 0
3: 9
4: 175
Right 1169475259 20:5925165-5925187 CATTAAATGTTTGACACAATTGG 0: 1
1: 0
2: 2
3: 15
4: 212

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169475256 Original CRISPR TCTGCCCTTGGGTAGATAAA TGG (reversed) Exonic
901290432 1:8119973-8119995 TCTGCCTTTGGGCAGATGAGAGG - Intergenic
901705262 1:11068506-11068528 TCTGCCCTTGGGAAGAAATGAGG + Intronic
905264694 1:36743571-36743593 TGTGCCCTTGGGAAGATAGAGGG + Intergenic
909626184 1:77718630-77718652 TCTCCCCTTAGGTTGAGAAATGG - Exonic
910066025 1:83151635-83151657 TCTGCCCTTTGGCAAATTAAAGG + Intergenic
910888792 1:91995264-91995286 TCTGCCCTTGGGTGGCCAAGTGG - Intronic
913334383 1:117695757-117695779 TCTGCTCTTGGCTAGCTAATTGG - Intergenic
913529412 1:119722978-119723000 TCTGACCTTGGTAAGATCAATGG + Intronic
913563819 1:120050350-120050372 TCTGCTCTTTGGTATATAACTGG - Intronic
913634306 1:120743213-120743235 TCTGCTCTTTGGTATATAACTGG + Intergenic
914284412 1:146209724-146209746 TCTGCTCTTTGGTATATAACTGG - Intronic
914545444 1:148660465-148660487 TCTGCTCTTTGGTATATAACTGG - Intronic
914621123 1:149410208-149410230 TCTGCTCTTTGGTATATAACTGG + Intergenic
915254438 1:154615336-154615358 TCTGCATTTGGGTACATCAAAGG + Intronic
915909727 1:159907052-159907074 TCTTACCTTGGGCAGATGAAAGG - Intergenic
920718791 1:208367519-208367541 TCTGGCCTTCTGTAGATAATGGG + Intergenic
922574636 1:226653684-226653706 GGTGCCCCTGGGTAGGTAAAGGG + Intronic
922699943 1:227753394-227753416 TCTGCCCTTGGGCAGGTTCACGG + Intronic
923349003 1:233085541-233085563 TCTGCCTCTTGGTAGATATATGG - Intronic
1064582593 10:16809380-16809402 TCTGTCTTTGGGTAGAGAGATGG - Intronic
1068942573 10:62693977-62693999 TCTGCCCTTTCTTAGATAGAAGG + Intergenic
1069375754 10:67790778-67790800 TCTACCTGTGGCTAGATAAAAGG - Intergenic
1070350299 10:75585153-75585175 GCTGCCCTTGGTGAGAGAAAGGG - Intronic
1071445232 10:85739907-85739929 TCTGGCATTGGGTAGAGCAATGG + Intronic
1072541063 10:96398261-96398283 ACTGGCCTAGGGTTGATAAAAGG + Intronic
1075917271 10:126179509-126179531 TTTGCCCTTGTGAAGAAAAATGG + Intronic
1078034345 11:7787136-7787158 TGTGTCCATGGATAGATAAATGG + Intergenic
1078357882 11:10646435-10646457 TCTGGGGTTGGGTAGATAATTGG - Intronic
1080058257 11:27929902-27929924 TCTCCTCTTGGGTAAATTAAAGG + Intergenic
1080337991 11:31221549-31221571 CCTGCCCTTTGAAAGATAAAAGG + Intronic
1081016276 11:37885500-37885522 TATGCTCTTGGGCAGATAGATGG + Intergenic
1082178952 11:49095527-49095549 TCTGCCCTGGGGTAGGTAGGGGG - Intergenic
1084652692 11:70498495-70498517 TCTGCCCCTGGGCACATGAAGGG - Intronic
1087622074 11:100554211-100554233 TCTGACCTTGGGCAAATAAGGGG - Intergenic
1087765877 11:102152790-102152812 GCTGTCCTTGGGTAATTAAAGGG + Intronic
1089303765 11:117514241-117514263 TCTTCCCTTGGGGATACAAAGGG + Intronic
1089410767 11:118240678-118240700 TCTGCCCATGGCTGGCTAAAAGG + Intronic
1092410874 12:8252198-8252220 TCAGCCCTTGGGTGGTTGAAGGG + Intergenic
1095238662 12:39831147-39831169 CCTGCTCCTTGGTAGATAAAAGG + Intronic
1095343358 12:41118988-41119010 TATGGCCTTGGGTAAATAAGTGG + Intergenic
1104040133 12:125124412-125124434 TCTGCAGTTGGGAAGATAATGGG + Intronic
1104198814 12:126567393-126567415 TCAGCCCTTGGGTGGATGATGGG - Intergenic
1106565478 13:30881133-30881155 CATGTCCTTGGGAAGATAAAGGG - Intergenic
1108161993 13:47650367-47650389 TCTGCCTTGGGGGAGGTAAAGGG - Intergenic
1108873172 13:55012368-55012390 TATGCCTTTGAGTAGATAAATGG - Intergenic
1111832472 13:93346556-93346578 TCTACACTTGGGGACATAAAAGG - Intronic
1111863520 13:93739308-93739330 TGTGCCCTTGAATATATAAAAGG + Intronic
1113333912 13:109359748-109359770 TCTACTCATAGGTAGATAAATGG + Intergenic
1113715170 13:112499935-112499957 TATGGCCTTGGGTATATAGATGG - Intronic
1114948053 14:27711839-27711861 TTTGCCTTTGGGTAGATACCGGG + Intergenic
1115369258 14:32593543-32593565 GCTGCCCTTGGGTAGATGAGTGG + Intronic
1116441145 14:44954591-44954613 TCTTCCCTATCGTAGATAAATGG - Intronic
1117136412 14:52738717-52738739 TCTGTCCTTAGGTAGGTAACAGG - Intronic
1121451446 14:94010854-94010876 TCTGCACTGGGGAAGATTAATGG - Intergenic
1122572004 14:102710462-102710484 TGTGGCCTTGGGTAGAAAGACGG + Intronic
1122664226 14:103317575-103317597 TCTGCTCTTGGCCAGATTAACGG - Intergenic
1127913592 15:63437717-63437739 TCTGCCCTTGGCTGGAGAGATGG + Intergenic
1130911616 15:88274847-88274869 TCTGCCCTTGGGTGGCGAGATGG - Intergenic
1135144914 16:19953027-19953049 TGTGCTCTTGGGTACATAGAAGG + Intergenic
1136640850 16:31563892-31563914 TCTGCCCTTTGGAACAAAAAAGG + Intergenic
1137011259 16:35322742-35322764 TCTGACCTTAGGGAGGTAAAGGG + Intergenic
1137029924 16:35512895-35512917 TCTGACCTTCGGGAGGTAAAGGG + Intergenic
1137036981 16:35576044-35576066 TCTGCCCTTGGGAAGAGACATGG + Intergenic
1139125482 16:64072335-64072357 TCTGCCCTTGGGTGGTTGATGGG + Intergenic
1139901900 16:70334693-70334715 TCTTGCCTTGGACAGATAAATGG - Exonic
1140548840 16:75841080-75841102 TAAGCCCTTTGGTAGAGAAAGGG + Intergenic
1142039810 16:87885746-87885768 TCTGCCCTTGGGTAGCCACGTGG + Exonic
1144464358 17:15485150-15485172 TCTGTCCTTAGGCAGATAAGGGG - Intronic
1145066689 17:19766286-19766308 TCTGCCCTTGGCTTGAGAAGGGG - Intergenic
1146515380 17:33485225-33485247 ACTGACCTTGAGTGGATAAAGGG + Intronic
1148729334 17:49822209-49822231 TCTGGCCTTGGGTCTTTAAAAGG - Intronic
1149981950 17:61317881-61317903 TCTGCCCTCAGGTGGCTAAAAGG - Intronic
1150004777 17:61462952-61462974 TCTGCCCTTGGGTTCTTGAAGGG - Intronic
1151138468 17:71969980-71970002 TCTGCCCTTGGCCAGATTTAAGG - Intergenic
1155972528 18:32094714-32094736 GTTGGCATTGGGTAGATAAAAGG + Intronic
1157800452 18:50616165-50616187 TCTTCCTTTGGGGGGATAAAAGG + Intronic
1160348685 18:78155326-78155348 ACAGCCCATGGGTAGATCAACGG - Intergenic
1160367813 18:78343778-78343800 TCTTGCCTTGGGTAGGTAAAAGG - Intergenic
1166425359 19:42673316-42673338 TCAGCCATTGGGTAGACTAAAGG - Intronic
1166463035 19:43006430-43006452 TCAGCCTTTGGGTGGATTAAAGG + Intronic
1166469178 19:43062986-43063008 TCAGCCTTTGGGTGGATTAAAGG + Intronic
1166480319 19:43166517-43166539 TCAGCCTTTGGGTGGATTAAAGG + Exonic
1166509489 19:43395265-43395287 TCTGCTTTTAGGTAGATAAGGGG + Intergenic
1166761127 19:45224978-45225000 TCTTCCCTTAGGTAGATCAGAGG + Intronic
925397432 2:3545328-3545350 TGTGCCCATGGGTACATTAAAGG - Exonic
926763897 2:16305421-16305443 TCTCCACTTGGCTAGACAAAAGG + Intergenic
928970238 2:37020350-37020372 TCTGCCCTTTAAGAGATAAAAGG - Intronic
929034139 2:37674309-37674331 TCTGCACTTAGGTAGATCACAGG - Intronic
930224670 2:48780018-48780040 TGTGCTCCTGGGCAGATAAATGG - Intergenic
930534715 2:52631415-52631437 TCTGCCCCTGTGGAGAGAAAGGG + Intergenic
930768319 2:55107668-55107690 TCAGGCTCTGGGTAGATAAAGGG + Intronic
931264421 2:60647834-60647856 TCTGTCCTTGGGGAGAAAATGGG - Intergenic
932018581 2:68059106-68059128 TCTGCTTTTGGTGAGATAAAGGG + Intronic
932493789 2:72136820-72136842 TCAGCCCTTGGGCAAATGAAGGG + Intronic
935257717 2:101327274-101327296 TCTTCCATTTGGTAGATAATAGG + Intergenic
936581466 2:113704429-113704451 TCAGCCCTTGGGTAGTTGATGGG + Intergenic
938440601 2:131328771-131328793 TCTGTCCATGGGAAGATGAAAGG + Intronic
946471847 2:219967678-219967700 TATACTCTTGGGTAGAAAAAGGG + Intergenic
946878350 2:224152715-224152737 TATTCCTTTGGGTATATAAATGG + Intergenic
1169475256 20:5925125-5925147 TCTGCCCTTGGGTAGATAAATGG - Exonic
1170406192 20:16040148-16040170 TCTGAGCTTAGGTAGATGAATGG - Intronic
1171302769 20:24078258-24078280 TCTGCCCTTAAATACATAAATGG + Intergenic
1173352088 20:42254530-42254552 TTTGCCTTTAGATAGATAAAGGG + Intronic
1174670510 20:52303251-52303273 TCTGCCATTAGGTAGATGGAGGG + Intergenic
1177301694 21:19254145-19254167 TCTGCCTTTGTGAAGATAAAAGG + Intergenic
1185000984 22:48245477-48245499 TCTGCTCTGCGTTAGATAAAAGG + Intergenic
949661545 3:6284349-6284371 TCTGCATTTGGGGAGATAATAGG - Intergenic
952627732 3:35427171-35427193 TCTTCCTTTGGGTAGATACCTGG - Intergenic
953694641 3:45147674-45147696 TCTGTCCTTGTGCAGAAAAATGG + Intergenic
954144478 3:48627673-48627695 TCTGCTCATGGGTAGAGGAAAGG - Intronic
955912234 3:63869155-63869177 TCTGCCCTTGGGTTGGGAAATGG + Intronic
956146273 3:66194365-66194387 TCTGTCATTGGAGAGATAAATGG - Intronic
957805189 3:85138924-85138946 TCTGCATTTAGGAAGATAAAGGG + Intronic
959707906 3:109356335-109356357 TCTGACCTTTGGAAGATAAGTGG + Intergenic
959933007 3:112003013-112003035 CCAGCCCTAGGGTAGAAAAATGG + Intronic
964768155 3:160198125-160198147 TCTACCCTAGGGAAGATAAGAGG - Intergenic
964778613 3:160309731-160309753 TCTTCCCTTTCTTAGATAAAAGG - Intronic
965702063 3:171468109-171468131 TCTGCTCATTGGTAGACAAAGGG + Intergenic
966257771 3:177938062-177938084 TCTGCTCTTGAGTTGCTAAAAGG + Intergenic
966649414 3:182282710-182282732 TGTGCCAATGGGTAGATAATGGG - Intergenic
968934493 4:3602886-3602908 TCTGCCCTTGGGAAGCTCACAGG - Intergenic
969843007 4:9897342-9897364 TCTGCCCTTGGGGAGCTTTATGG + Intronic
971322833 4:25619112-25619134 TCTGACTTTGGGCAGATATATGG + Intergenic
972970936 4:44575353-44575375 TCTACCTTTAGGCAGATAAAGGG + Intergenic
976895116 4:90100019-90100041 TCTGCATTTGGGTAGACAAATGG - Intergenic
977340186 4:95748209-95748231 TCTGGCTTTTGGTAGATCAAAGG + Intergenic
977581469 4:98729594-98729616 TCTGTCTTTAGGTAGATAAGGGG - Intergenic
983606590 4:169593610-169593632 TCTGAACTAGGGTAGACAAAGGG - Intronic
990087321 5:51994741-51994763 ACTGCCCCTGAGTTGATAAAAGG - Intergenic
990568559 5:57054962-57054984 TGGGGCCTTGGGTAGATCAAAGG - Intergenic
992612581 5:78520183-78520205 TGTGGCCTTGGGGAGATAAGCGG - Intronic
995494060 5:112723059-112723081 TCATGCCTTGGGTAGGTAAAAGG + Intronic
996660160 5:125993122-125993144 TCTGGGCTTGGGTAGTTACAAGG + Intergenic
1000545519 5:162596158-162596180 TGTGGACTTGGGTGGATAAAGGG + Intergenic
1001455977 5:171859878-171859900 TCTGCCATTCGGTAGAGAAGTGG + Intergenic
1004305401 6:14497456-14497478 TCTGCCCAAGGTGAGATAAAAGG - Intergenic
1004908564 6:20259859-20259881 TCAGCCCTTGGGTAGTCAATGGG - Intergenic
1005546069 6:26873134-26873156 TCTGCCCATTGGCAGATGAATGG + Intergenic
1007621566 6:43218538-43218560 TCTGCCGTTGTGTGGAGAAAAGG + Intronic
1007710515 6:43820531-43820553 TCTTGCCTTGGGCAGGTAAAAGG - Intergenic
1008496609 6:52140197-52140219 GCTGCCCCTGGGAAGTTAAATGG + Intergenic
1011257774 6:85441449-85441471 TCTGGCATTGATTAGATAAAAGG - Intergenic
1012211219 6:96521346-96521368 TCTGCCTTTTGGAAGATACATGG - Intergenic
1013824549 6:114195656-114195678 TATGCAATTAGGTAGATAAATGG + Intronic
1015314448 6:131802591-131802613 ATTTCCCTTGGGTAGATAACTGG - Intergenic
1016386437 6:143535541-143535563 TCTGTCTTTAGGCAGATAAAAGG - Intergenic
1016718424 6:147263153-147263175 TTTGCCATTGGGTAAACAAAAGG + Intronic
1017204678 6:151791849-151791871 TCTAACTTTGTGTAGATAAAAGG - Intronic
1017570924 6:155743147-155743169 TCTGGCCTTTGGAAGATAACTGG + Intergenic
1017614928 6:156236290-156236312 TATTCCTTTGGGTAGAGAAAGGG - Intergenic
1018809950 6:167291855-167291877 TTTGCCTTTGGGTGGTTAAAAGG + Intronic
1019897764 7:3995793-3995815 TAAGGCCTTGGATAGATAAATGG - Intronic
1021179779 7:17492677-17492699 TCTGCCACTGTGTAAATAAAGGG + Intergenic
1021524652 7:21573841-21573863 TCTGCCCTTTGGTATATACATGG + Intronic
1023027423 7:36063389-36063411 TCTGCCCTAGGCTAAATAATTGG + Intergenic
1026340576 7:69430657-69430679 TCTGCCCCTGGGCAAATCAAAGG - Intergenic
1026624626 7:71981247-71981269 CCTGCCTTTGGGCAGATGAAAGG - Intronic
1027278085 7:76583140-76583162 TCTGCCCTTTGGCAAATTAAAGG - Intergenic
1027548906 7:79566232-79566254 TCTGCCTTTGAACAGATAAAGGG + Intergenic
1027579980 7:79980533-79980555 GATGCCCTTGGCTAGATAACTGG - Intergenic
1028859400 7:95631698-95631720 TCTGCCCCTGGCTATATACAGGG + Intergenic
1028960380 7:96742247-96742269 TCTTCCCAAGGGTTGATAAAGGG + Intergenic
1032676610 7:134135398-134135420 TCTGCCTTGAGGCAGATAAAGGG + Intronic
1034885452 7:154795042-154795064 TCCGCCCCAGGTTAGATAAAAGG - Intronic
1038507887 8:28101476-28101498 GTTGCCCTAGGGTAGAAAAAGGG - Intronic
1039134386 8:34303539-34303561 TCTGACCTTGGTAAGAAAAAAGG - Intergenic
1039254257 8:35701642-35701664 TCTGCCCTTGTGTATATGAGGGG - Intronic
1039985303 8:42442279-42442301 TGTGACCTTGGGTTGAGAAAGGG - Intronic
1046780147 8:118205909-118205931 TCAGCCCTTGGGGAAAAAAAAGG + Intronic
1047893440 8:129338452-129338474 TCTCCCCTTGTGTAGATACTTGG - Intergenic
1048067767 8:130988292-130988314 AATACCCTTGGGTAAATAAAGGG + Intronic
1048401739 8:134077598-134077620 TCTGCCCTTAGGCAGATATTGGG + Intergenic
1050061752 9:1716819-1716841 GCTGCCATTGGGTAGAGACATGG - Intergenic
1050470264 9:5981156-5981178 TCTTCCCTTGGGTTCATCAATGG + Intronic
1050607411 9:7315975-7315997 TCAGCCCTGGGTGAGATAAAGGG + Intergenic
1050703785 9:8371507-8371529 TCTTCCTGTGGGAAGATAAATGG + Intronic
1050919279 9:11180265-11180287 TCTACCTTTGGGTAGAAAAGGGG - Intergenic
1053105771 9:35406541-35406563 CCTGCCTTTGGGTAGATCACAGG - Intergenic
1054455665 9:65429094-65429116 TCTGCCCTTGGGAAGCTCACAGG + Intergenic
1188065126 X:25649374-25649396 TCTGGCCTTGGGTAAGTAGAAGG + Intergenic
1192112975 X:68383967-68383989 TCTGACCTGGGCTAAATAAACGG + Intronic
1194126634 X:90026395-90026417 TATTCCCTTGGGTATATAATGGG - Intergenic
1198238430 X:134759561-134759583 TTTTCCTTTGGGTAGATACATGG - Intronic
1198743077 X:139861919-139861941 TCTTCCCTTGGGCAGGTGAAAGG - Intronic
1198872258 X:141188545-141188567 TCAGCCCTTGGGTAGTTGATGGG + Intergenic