ID: 1169478071

View in Genome Browser
Species Human (GRCh38)
Location 20:5950327-5950349
Sequence CATCCGCGACGGCGACTTCG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 21
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 18}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169478071_1169478078 6 Left 1169478071 20:5950327-5950349 CCACGAAGTCGCCGTCGCGGATG 0: 1
1: 0
2: 0
3: 2
4: 18
Right 1169478078 20:5950356-5950378 TCTCCGGGATGCTGTGGTTGTGG 0: 1
1: 0
2: 0
3: 16
4: 195
1169478071_1169478081 12 Left 1169478071 20:5950327-5950349 CCACGAAGTCGCCGTCGCGGATG 0: 1
1: 0
2: 0
3: 2
4: 18
Right 1169478081 20:5950362-5950384 GGATGCTGTGGTTGTGGGCCCGG 0: 1
1: 0
2: 3
3: 22
4: 370
1169478071_1169478077 0 Left 1169478071 20:5950327-5950349 CCACGAAGTCGCCGTCGCGGATG 0: 1
1: 0
2: 0
3: 2
4: 18
Right 1169478077 20:5950350-5950372 CGGTGGTCTCCGGGATGCTGTGG 0: 1
1: 0
2: 1
3: 8
4: 130
1169478071_1169478076 -9 Left 1169478071 20:5950327-5950349 CCACGAAGTCGCCGTCGCGGATG 0: 1
1: 0
2: 0
3: 2
4: 18
Right 1169478076 20:5950341-5950363 TCGCGGATGCGGTGGTCTCCGGG 0: 1
1: 0
2: 0
3: 5
4: 46
1169478071_1169478075 -10 Left 1169478071 20:5950327-5950349 CCACGAAGTCGCCGTCGCGGATG 0: 1
1: 0
2: 0
3: 2
4: 18
Right 1169478075 20:5950340-5950362 GTCGCGGATGCGGTGGTCTCCGG 0: 1
1: 0
2: 0
3: 3
4: 102
1169478071_1169478079 7 Left 1169478071 20:5950327-5950349 CCACGAAGTCGCCGTCGCGGATG 0: 1
1: 0
2: 0
3: 2
4: 18
Right 1169478079 20:5950357-5950379 CTCCGGGATGCTGTGGTTGTGGG 0: 1
1: 0
2: 1
3: 20
4: 276

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169478071 Original CRISPR CATCCGCGACGGCGACTTCG TGG (reversed) Exonic
902338030 1:15765046-15765068 CCTCCGCCACGGCCACATCGCGG - Exonic
1069526927 10:69180513-69180535 CAGCGCCGACGGCGACGTCGGGG + Exonic
1089243040 11:117098181-117098203 CATCGGCAAGGGCAACTTCGCGG - Exonic
1091596965 12:1884812-1884834 CATCAGCGACGGCGCCGTGGAGG - Exonic
1104854367 12:131895064-131895086 GATCGGCCACGGCGCCTTCGCGG + Exonic
1132523038 16:400225-400247 CATCCACGCCAGCGACTCCGTGG + Exonic
1158373801 18:56840223-56840245 CATCCGTGACAGTGACTTAGAGG + Intronic
1163530765 19:17847679-17847701 CATGCGCGACGGGGGCTGCGGGG - Intronic
1168315951 19:55484868-55484890 CATCCGTGCCGGGGCCTTCGCGG - Intergenic
927887554 2:26727980-26728002 CATCGGCTTCGGCGACTACGTGG + Exonic
929858120 2:45652364-45652386 CATAGGCTACGACGACTTCGTGG + Exonic
932837313 2:75049659-75049681 CATCAGCGCCGGCGACTATGAGG - Exonic
934620425 2:95800054-95800076 CATCCGCCAGGGCGACTTGCTGG + Intergenic
942558637 2:177198091-177198113 CATCTGCGACGGCGGCCTCCAGG - Intergenic
948375878 2:237519927-237519949 CGTCCACGACTTCGACTTCGAGG + Exonic
1169478071 20:5950327-5950349 CATCCGCGACGGCGACTTCGTGG - Exonic
1173663551 20:44750442-44750464 CATCGGCTTCGGCGACTTCGTGG + Exonic
951016928 3:17742218-17742240 CACCCCCGACGCCGACTCCGAGG + Intronic
984857165 4:184205345-184205367 CATCCGCCACGGTGACCTTGTGG + Intronic
1004705647 6:18121865-18121887 CCTCCTGGACGTCGACTTCGCGG - Exonic
1062334229 9:136057923-136057945 CATTAGAGACGGCGACTTCGCGG + Intronic