ID: 1169479846

View in Genome Browser
Species Human (GRCh38)
Location 20:5969747-5969769
Sequence GCTTTTATTCAGAGGGAAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 373
Summary {0: 1, 1: 0, 2: 4, 3: 32, 4: 336}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169479846_1169479851 3 Left 1169479846 20:5969747-5969769 CCTACTTCCCTCTGAATAAAAGC 0: 1
1: 0
2: 4
3: 32
4: 336
Right 1169479851 20:5969773-5969795 TCAGACCCACCCTGGAAGAGAGG 0: 1
1: 0
2: 0
3: 21
4: 200
1169479846_1169479856 26 Left 1169479846 20:5969747-5969769 CCTACTTCCCTCTGAATAAAAGC 0: 1
1: 0
2: 4
3: 32
4: 336
Right 1169479856 20:5969796-5969818 CTGCTCTAACTTAGCGTTGCTGG 0: 1
1: 0
2: 0
3: 1
4: 35
1169479846_1169479857 27 Left 1169479846 20:5969747-5969769 CCTACTTCCCTCTGAATAAAAGC 0: 1
1: 0
2: 4
3: 32
4: 336
Right 1169479857 20:5969797-5969819 TGCTCTAACTTAGCGTTGCTGGG 0: 1
1: 0
2: 0
3: 3
4: 36
1169479846_1169479849 -5 Left 1169479846 20:5969747-5969769 CCTACTTCCCTCTGAATAAAAGC 0: 1
1: 0
2: 4
3: 32
4: 336
Right 1169479849 20:5969765-5969787 AAAGCCATTCAGACCCACCCTGG 0: 1
1: 0
2: 1
3: 16
4: 162
1169479846_1169479858 28 Left 1169479846 20:5969747-5969769 CCTACTTCCCTCTGAATAAAAGC 0: 1
1: 0
2: 4
3: 32
4: 336
Right 1169479858 20:5969798-5969820 GCTCTAACTTAGCGTTGCTGGGG 0: 1
1: 0
2: 1
3: 3
4: 51

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169479846 Original CRISPR GCTTTTATTCAGAGGGAAGT AGG (reversed) Intronic
901062874 1:6481220-6481242 GCTTTTATTCAGAGTGAGATGGG - Intronic
901239871 1:7686589-7686611 GCTTTTATTCTGAGGTCAGTGGG + Intronic
901579458 1:10229027-10229049 GCTGTATTTCAGAGGGAACTCGG + Intronic
901690713 1:10971403-10971425 GATTTTATTCCAAGGGTAGTGGG - Intronic
902056684 1:13606504-13606526 GCTTTTAAAAAGATGGAAGTTGG + Intronic
902188910 1:14746724-14746746 GGTTTTAGTCAGTGGAAAGTGGG + Intronic
903420332 1:23214475-23214497 AATTTTATTCAGAGTGAAGTGGG - Intergenic
906856385 1:49310234-49310256 CTTTTGATTCTGAGGGAAGTAGG + Intronic
907513282 1:54978220-54978242 GTTGTTATTCTGAGGGCAGTGGG + Intergenic
907661047 1:56392711-56392733 CTTTTTATTCTGAAGGAAGTGGG - Intergenic
908319889 1:62968923-62968945 GATTGTATTCAGAGGTAAATAGG + Intergenic
909984311 1:82141859-82141881 ATTCTTATTCAGAGGGTAGTGGG + Intergenic
911162416 1:94694401-94694423 GCTTTTACTCTGAGTGATGTGGG + Intergenic
912451248 1:109769007-109769029 GTTTTTATTCCAAGGGCAGTTGG + Intronic
913032971 1:114930792-114930814 TCTTTTATTCAGATGGATATTGG - Intronic
913588660 1:120301605-120301627 GCTTTTACTCAGAGTGACATGGG + Intergenic
913619525 1:120596764-120596786 GCTTTTACTCAGAGTGACATGGG - Intergenic
914570682 1:148913476-148913498 GCTTTTACTCAGAGTGACATGGG + Intronic
914602149 1:149216793-149216815 GCTTTTACTCAGAGTGACATGGG - Intergenic
914830886 1:151169998-151170020 GCTTTTATTTACAGGAAAGGAGG + Exonic
915505285 1:156351674-156351696 GCTTTTACTCTGAGTGAAATGGG + Intronic
916489219 1:165286771-165286793 GCTTGTTTTCAGAGCCAAGTAGG - Intronic
916511342 1:165474705-165474727 GCTTTTACTCTGAGTGAAATGGG + Intergenic
917101256 1:171447787-171447809 GCTTTTATCTTGAGTGAAGTAGG - Intergenic
917343532 1:174004902-174004924 GCTTTTTTTTAGAGGGGGGTGGG + Intronic
917623163 1:176818783-176818805 GCTTTTATTCTGGATGAAGTGGG - Intronic
919131341 1:193454776-193454798 GGTTTTATTCTGAGAGAAATAGG + Intergenic
921882864 1:220274037-220274059 GCATTTCTTCAGATGGAAGAAGG - Intergenic
923323212 1:232857107-232857129 GCTTTTTTTCACTGGGGAGTGGG - Intergenic
923439838 1:234006788-234006810 GCTTTTATGCTGAATGAAGTGGG + Intronic
923439924 1:234007533-234007555 GCTTTTATGCCGAACGAAGTGGG + Intronic
924358332 1:243208401-243208423 ACTTTTATTCTGAGTGAAATGGG - Intronic
1063601552 10:7485871-7485893 GATGTTATTCCGAGTGAAGTGGG - Intergenic
1064464888 10:15569076-15569098 GCATTTTTCCAGTGGGAAGTGGG + Intronic
1064909623 10:20385583-20385605 GCTTTGACTCAGAGGGACATGGG + Intergenic
1064931802 10:20636885-20636907 GCTTTTATCCTGAGTGAGGTAGG + Intergenic
1065711954 10:28526909-28526931 GCTTTTATTCTGAGTTAATTGGG - Intergenic
1068683401 10:59843984-59844006 GCTTTTATTCAGAGGGCACTTGG - Intronic
1070207114 10:74274956-74274978 CCTTTTTTTTATAGGGAAGTGGG + Intronic
1072299326 10:94043889-94043911 CTTTTTATTCAGAGGAAAGAGGG + Intronic
1074324246 10:112432465-112432487 TCCTTTATTCAGAGGGCAGCAGG + Exonic
1074550877 10:114441045-114441067 GCTGTTATACTGAGCGAAGTCGG + Exonic
1075072748 10:119329758-119329780 GCTTTTCTGCAGGGGGAAGGAGG - Intronic
1075357934 10:121799677-121799699 GCATTTGTTCAGAGAGAAGATGG - Intronic
1075429275 10:122366786-122366808 GATTTTATTCTGAGGCAATTGGG + Intergenic
1075686215 10:124367057-124367079 ACTTTTACTCTGAGGGAAGCAGG - Intergenic
1077843436 11:5999279-5999301 CCTATTATTCAGAGGGCAGCAGG + Intergenic
1079368337 11:19828731-19828753 CCTTTAATTCAGTGGGAAGTGGG + Intronic
1079370604 11:19848835-19848857 GCTATCATTCAGAGAGATGTAGG - Intronic
1080082907 11:28241921-28241943 GCTTTTATTCTAAGTGAAATGGG + Intronic
1083395306 11:62387270-62387292 GCTTTTATTCTGAGTTAAATGGG - Intronic
1083929327 11:65831651-65831673 TCTCTGGTTCAGAGGGAAGTGGG - Intronic
1083991669 11:66249947-66249969 GCCTCTATTCAGAGGGCACTGGG - Intergenic
1084359899 11:68662447-68662469 GCTGAGATCCAGAGGGAAGTGGG + Intergenic
1084768856 11:71329789-71329811 GCTTTTATTCAAGGAGAAATGGG - Intergenic
1086333052 11:85773048-85773070 TCTTTTATACAGTGGGAAGTAGG - Intronic
1086380598 11:86248511-86248533 ACTTTTACTCAGAGGGAACCAGG + Intronic
1088200396 11:107326557-107326579 TCCTTGGTTCAGAGGGAAGTGGG - Exonic
1088348959 11:108863201-108863223 GATCTTATTAAGGGGGAAGTAGG + Intronic
1088900734 11:114115063-114115085 TCTTTTGTTAAGAGGGAGGTAGG + Intronic
1089670800 11:120055703-120055725 GGTTTTATCCAGAGGGCAATGGG + Intergenic
1090213016 11:124936114-124936136 CTGTGTATTCAGAGGGAAGTTGG - Exonic
1090908694 11:131099123-131099145 GCTTTTACTCTGAGGGATGCAGG + Intergenic
1091546981 12:1507775-1507797 TTTTTCAATCAGAGGGAAGTTGG - Intergenic
1091655523 12:2343753-2343775 GCTATTATTTACAGGGCAGTAGG + Intronic
1092185119 12:6473117-6473139 GTTTTTTTTCAGGGGAAAGTTGG - Intergenic
1093803920 12:23409302-23409324 GCTTTTACTCTGAGTGAAATGGG + Intergenic
1094372111 12:29750110-29750132 GATTTTATTCTGAGGGGAATGGG - Intronic
1094436170 12:30423136-30423158 GCTTTTACTCTGAGAGAAATAGG - Intergenic
1095424185 12:42057393-42057415 GCTTTTAGTCAGATGGAGGAGGG + Intergenic
1095555421 12:43498057-43498079 ACCTTTATTCATAGGGAATTTGG - Intronic
1095878250 12:47105165-47105187 GCTCCTATACAGAGGGGAGTGGG + Intronic
1096463067 12:51833472-51833494 GCTTTTATTCTGAGTGAGATGGG - Intergenic
1096860627 12:54525162-54525184 GCTTTTATTCTGAGTGAGATGGG + Intronic
1097330029 12:58323041-58323063 GTTTTTATTTAGAGTGAATTAGG - Intergenic
1099506160 12:83478881-83478903 CCTTTAATTCAGAGGGCATTGGG - Intergenic
1099987899 12:89689403-89689425 TCTTTGATTCAGAAGGAAATTGG + Intronic
1101384528 12:104245049-104245071 ACTTTTATTGAAAGGGAATTTGG + Intronic
1101556738 12:105816994-105817016 ACTTTGGGTCAGAGGGAAGTGGG - Intergenic
1101777478 12:107807399-107807421 GCTCTTCTTCAGAGGGATGATGG + Intergenic
1102162799 12:110782996-110783018 GCTTTTATTCTGAGTGAGATGGG + Intergenic
1102659405 12:114512903-114512925 CCTTTTATGAAGGGGGAAGTAGG - Intergenic
1102749676 12:115281427-115281449 GCTTTTACTCCAAGGGAACTGGG + Intergenic
1104557392 12:129813377-129813399 GATTTTATTCACAGGAAAATGGG - Intronic
1106061949 13:26301895-26301917 GCTTTTGTTCAGTGAGAAGTTGG + Intronic
1106080223 13:26494270-26494292 CCTCTTATTCAGTGGCAAGTTGG - Intergenic
1107020167 13:35743138-35743160 GCCTTATTTCAGAGGGAAGAGGG + Intergenic
1107396676 13:40025251-40025273 GCTGATATCCAGAGAGAAGTGGG + Intergenic
1107462314 13:40615886-40615908 GCTTTCATGCTGAGGGAGGTAGG + Intronic
1109383524 13:61597476-61597498 GCTTTTATTCTGAGTAAAATAGG + Intergenic
1109852966 13:68091329-68091351 GCTTCTATTCACAGGATAGTAGG + Intergenic
1110157156 13:72331358-72331380 GATTTTATTCTGAGGGCAGTTGG + Intergenic
1110768663 13:79309598-79309620 GTTTTTATTCAAATGGAAATGGG - Intergenic
1110890204 13:80689194-80689216 ACTTATATTTAAAGGGAAGTAGG - Intergenic
1111613839 13:90639731-90639753 GATATGATTCTGAGGGAAGTAGG + Intergenic
1111658910 13:91184811-91184833 GCTGTTTTTAAGGGGGAAGTGGG - Intergenic
1111760937 13:92463075-92463097 GCTTTTATTCAGAGAATAGAGGG + Intronic
1112723121 13:102269460-102269482 AATTTTATTCAGATGTAAGTAGG + Intronic
1113456814 13:110455209-110455231 GCTTTTACCCCGAGGGCAGTAGG - Intronic
1113458307 13:110464515-110464537 GCTTTTTTTCACAGGGGAGGGGG - Intronic
1113565944 13:111319967-111319989 GCCTTTATTCTGAGCAAAGTAGG - Intronic
1114318476 14:21526966-21526988 GCTATTATTCAGGGGGAGGAGGG - Intronic
1117515074 14:56492691-56492713 GCTTTGATTAAGAGGAAATTAGG + Intronic
1117839146 14:59840201-59840223 ACTTTTATTGATAGTGAAGTTGG + Intronic
1118231529 14:63955280-63955302 GCTTTAACTCAGAGGGAGGGAGG - Intronic
1119045262 14:71313385-71313407 GGTTTTCATAAGAGGGAAGTAGG - Intergenic
1120383369 14:83811429-83811451 GCTTTTGTTCTGAGGGAATTGGG + Intergenic
1121170349 14:91848565-91848587 GTTTTTCTTCAGAGAGAAATTGG - Intronic
1121629666 14:95413083-95413105 GCTTGTCCTCAGAGGAAAGTTGG + Intronic
1121806444 14:96829215-96829237 TTTTTTTTTGAGAGGGAAGTGGG + Intronic
1122515601 14:102306234-102306256 TTTTTTTTTAAGAGGGAAGTGGG - Intergenic
1202841879 14_GL000009v2_random:128801-128823 TCTTTTTATCACAGGGAAGTTGG - Intergenic
1202911272 14_GL000194v1_random:119044-119066 TCTTTTTATCACAGGGAAGTTGG - Intergenic
1123439712 15:20281620-20281642 GCTTGTTTTCAGAGGGAAAGCGG - Intergenic
1124149348 15:27163193-27163215 GATTTAATTTAGAGGGCAGTAGG - Intronic
1125309266 15:38360738-38360760 GCTTTTATTCTGAGGGTAATAGG + Intergenic
1125729436 15:41884682-41884704 GCTTTTACTCAGAGAGATGATGG - Intronic
1126178836 15:45765276-45765298 CCTTATATTCAAAGGCAAGTAGG - Intergenic
1126477768 15:49084033-49084055 GGTTATTTTCAGATGGAAGTGGG - Intergenic
1128393780 15:67202347-67202369 GCTTTTATTGGGAGGAAAGGAGG - Exonic
1129751229 15:78065981-78066003 GCTTTTCACCAGAGAGAAGTGGG - Intronic
1129985541 15:79917050-79917072 GCTTTTATTTAGAGTGCAGAGGG + Intronic
1131231067 15:90659962-90659984 GATTTTATTCTGAGGTTAGTGGG + Intergenic
1131389282 15:92034030-92034052 GCTTTTATGCAGAAGGACCTGGG + Intronic
1131534079 15:93219804-93219826 GCTTTTATTCAAAGGGGTGATGG - Intergenic
1131692461 15:94841991-94842013 GCTTTTATTCATGGAGAGGTGGG + Intergenic
1132973567 16:2700726-2700748 GCTTTCATTCAGAGGGACACTGG - Intronic
1133496487 16:6323030-6323052 CCTTATATGCAGAGGGAAGCTGG - Intronic
1134058261 16:11183403-11183425 GCTTTTCTCCAAAGGAAAGTTGG + Intergenic
1134861549 16:17564840-17564862 GCTTTTCTTAAGAGGGGAGGGGG + Intergenic
1135183880 16:20298213-20298235 GATTTTATTCTAAGGGTAGTGGG + Intergenic
1136043143 16:27596041-27596063 GCTTTTACTCTGGGGGCAGTGGG + Intronic
1137365138 16:47853602-47853624 GCTTTTATGCAGAGGTAAACAGG + Intergenic
1137439587 16:48486476-48486498 GCCTTTATTATGAGGAAAGTAGG - Intergenic
1137891107 16:52162795-52162817 GCTGTTATTCAGAGAGAAGCAGG - Intergenic
1138200658 16:55085858-55085880 GCTTTTATTCTGAGTGTGGTGGG + Intergenic
1140858859 16:79001745-79001767 GCGTTTGTGCAGTGGGAAGTTGG + Intronic
1141396561 16:83710283-83710305 GCTTTTAATCAGAGGTCATTTGG - Intronic
1141691457 16:85599124-85599146 AATTTTATTCAGAGAGAATTGGG - Intergenic
1143069095 17:4275204-4275226 ACTTTTATTAAAAGGGAAGAGGG - Intronic
1143927880 17:10389212-10389234 GCCTTTACTCAGAGTGAAGTGGG - Intergenic
1143959673 17:10705584-10705606 CCTTTTATTCAGCAGGAAGATGG + Intronic
1146085899 17:29829374-29829396 GCTCTTAATAAAAGGGAAGTTGG - Intronic
1146775616 17:35612121-35612143 TCTTCTATTCAGAGAGCAGTTGG - Intronic
1148227429 17:45908737-45908759 GCTTTTAGTTAGAGGGAGGGTGG - Intronic
1148706730 17:49640673-49640695 GCTTTCACTCAGAGGGAGTTGGG - Intronic
1150098354 17:62399159-62399181 GCTTTTACTCTGAGGGAAATGGG - Intronic
1150310211 17:64122131-64122153 GCTTCTCTTCAAAGGGAGGTAGG + Intronic
1150910956 17:69386957-69386979 GCTTTTATTCGGAGTGGAATGGG + Intergenic
1151378594 17:73708977-73708999 CATTTTCTCCAGAGGGAAGTTGG - Intergenic
1151790627 17:76303482-76303504 GATTTTAATCAGATGAAAGTAGG + Intronic
1153262275 18:3236100-3236122 GCTTTTACTCTGAGTGAAGTAGG + Intergenic
1153702323 18:7708474-7708496 GCTTTAATTCAGTGGGAGGAGGG - Intronic
1155710343 18:28869542-28869564 GCTTTTATTCTCAGGGCAATGGG - Intergenic
1156196205 18:34776742-34776764 GCTTTTACCATGAGGGAAGTGGG - Intronic
1157692688 18:49697036-49697058 GCTTTTATCCATAGGGGAGTTGG + Intergenic
1160507735 18:79436811-79436833 CCTTTCCTTCAGAGGGAAGGAGG + Intronic
1160758581 19:771476-771498 GCTTCTACCCAGAGGGAAATGGG - Intergenic
1161262458 19:3345425-3345447 GCTTTGATCCTGAGGGAGGTGGG - Intergenic
1161623176 19:5309966-5309988 GCGTTTACTCTGAGGGAGGTGGG - Intronic
1161760558 19:6168076-6168098 GCTTTTACCTGGAGGGAAGTGGG - Intronic
1162449840 19:10748119-10748141 GCTTTTATTCCAAGTGAAGCGGG + Intronic
1162774416 19:12970278-12970300 GCTTTTGTTCTGAGTAAAGTGGG - Intronic
1163565111 19:18046492-18046514 GCTTTTACTCTGAGGAAGGTGGG + Intergenic
1163832060 19:19551795-19551817 GCTTCTAGGCAGAGGGATGTTGG + Intergenic
1165894413 19:39132885-39132907 GATTTTAATCAGAGCAAAGTGGG + Intronic
1166277185 19:41762125-41762147 GCTATTATTCACAGTGATGTTGG - Exonic
1166673915 19:44727721-44727743 GCTTTTACTCAGAGGGAGATGGG - Intergenic
1166714549 19:44958346-44958368 GCCTTTACTCTGAGGGAAATAGG + Intronic
925400832 2:3571368-3571390 TCTCTAATTCAGAGTGAAGTTGG - Intergenic
927105733 2:19822255-19822277 TCTTTTATTAAGAATGAAGTTGG - Intergenic
928187531 2:29125861-29125883 GCTTTTAATCAAAAGAAAGTGGG - Intronic
928558318 2:32449093-32449115 GATTTTCTTCAGAGGGAAAGAGG - Intronic
928985198 2:37173950-37173972 GCTTTCACTTTGAGGGAAGTGGG - Intronic
930193670 2:48486805-48486827 GCTTTTTTTCTGAGGGACATAGG + Intronic
930642990 2:53873366-53873388 GATTTTACTCACAGGAAAGTAGG - Intronic
930681217 2:54258501-54258523 GCTTTTATTCTTAGTGAAATGGG + Intronic
930851827 2:55969339-55969361 GATTTTAGTCAGAGAGAACTAGG - Intergenic
932835357 2:75030871-75030893 GATTTTATTCTGAGAGCAGTGGG + Intergenic
932919006 2:75888565-75888587 CCATTTATTTAGAGAGAAGTAGG + Intergenic
933102180 2:78274583-78274605 GCTTGGATACAGAGGGAGGTGGG + Intergenic
937529137 2:122807921-122807943 GCTTTTACTCTGAGTGATGTTGG + Intergenic
937770966 2:125720780-125720802 GCTTATGTTCAGAGAGAAGATGG + Intergenic
939491159 2:142878285-142878307 GCTTTTATTTTGAGGCCAGTGGG + Intronic
940904428 2:159156400-159156422 ACTTTTATTCAGACTGTAGTTGG + Intronic
941225486 2:162841805-162841827 GCTTTTATAGAGAGTGGAGTGGG - Intergenic
941428979 2:165388853-165388875 GCCTATGTTAAGAGGGAAGTTGG + Exonic
941442460 2:165555259-165555281 GCTTTCATTCTGGTGGAAGTGGG - Intronic
941479789 2:165992176-165992198 GCCTATGTTAAGAGGGAAGTTGG - Exonic
941580516 2:167292361-167292383 GCGTTTATTTGGAGGGAAGACGG + Intergenic
942549985 2:177105248-177105270 CCATTTATTCTGGGGGAAGTTGG - Intergenic
943076171 2:183197918-183197940 GTTTTTACTCTGAGGGACGTAGG - Intergenic
943090405 2:183367429-183367451 GCTTTTATTCATATGGTTGTTGG + Intergenic
944429919 2:199622223-199622245 GCTTATAGGCAGAGGAAAGTAGG - Intergenic
945223920 2:207512374-207512396 GCTTTTACTCTGAGCGAAATGGG + Intergenic
947612184 2:231531081-231531103 GCTCTTTTTCAGAAGGCAGTGGG - Intergenic
1169419100 20:5444904-5444926 GCTGTTCTCCAGAGGGTAGTTGG - Intergenic
1169479846 20:5969747-5969769 GCTTTTATTCAGAGGGAAGTAGG - Intronic
1169695005 20:8377396-8377418 GCTTTTCTTCTGATGGAAGAGGG + Intronic
1169955280 20:11096060-11096082 GCTTTTACTCTGAGTGAACTGGG + Intergenic
1170951367 20:20939047-20939069 GTATTTATTAAGTGGGAAGTTGG - Intergenic
1172314936 20:33946390-33946412 TGTTTTTTTCAGAGGAAAGTGGG - Intergenic
1173222759 20:41142966-41142988 CCTTTGATTCAGAGGCAAGGAGG + Intronic
1173447268 20:43130236-43130258 TCTTTTATTGAGATGGAAGGAGG + Intronic
1173849557 20:46209431-46209453 GCTTTTATTCTGAGCCTAGTAGG + Intronic
1174080982 20:47970615-47970637 GCTTTTACTCTGAGGGAAGTGGG - Intergenic
1174114566 20:48218147-48218169 GCTTTTGTTCTGAGTGAGGTGGG - Intergenic
1174135532 20:48376248-48376270 GCTTTTACTCTGAGGGAAGTGGG + Intergenic
1175062115 20:56253057-56253079 GCTTTTATTCAAAAGGTAATGGG - Intergenic
1175206880 20:57317902-57317924 GCTTTTATGCTGAGGGAGGCGGG - Intergenic
1175564681 20:59963807-59963829 GCTTTCATTCAGGGAGAATTTGG - Intronic
1176630623 21:9133711-9133733 TCTTTTTATCACAGGGAAGTTGG - Intergenic
1177967452 21:27745819-27745841 CCTTTCATTCAGATGGAAGATGG + Intergenic
1178741141 21:35202638-35202660 GCTAATATTCAGAGGAAATTTGG + Intronic
1179061385 21:37982664-37982686 GCTATGAATCAGAAGGAAGTGGG + Intronic
1180645708 22:17337162-17337184 GCTTCTATTCTGAGGGAAGAAGG - Intergenic
1182042704 22:27250709-27250731 GCTTTTATTCTGAGTGGGGTGGG + Intergenic
1183651161 22:39153757-39153779 GATTTTATTGTGAGGGAAATAGG - Intergenic
1183662738 22:39231018-39231040 GCTTTTCTTCGGAGGGACGGGGG - Intronic
1183836619 22:40459389-40459411 GCTTTTCTAGAGAAGGAAGTAGG - Intronic
1184563221 22:45275437-45275459 GGCTTTATTCAGAGGACAGTGGG + Intergenic
1184696216 22:46140535-46140557 GCTTGTTTTCAGAGGGAAAGGGG - Intergenic
1184777575 22:46631082-46631104 GCTTTTATTGTGCAGGAAGTTGG + Intronic
1185256597 22:49836797-49836819 GCTTTTATTCCCAGGGAGATGGG - Intergenic
1185391454 22:50563530-50563552 CTTTTTTTTCAGAGGGACGTGGG + Intergenic
949421838 3:3873924-3873946 GCTTTCACTCAGAGTGAGGTGGG - Intronic
950711363 3:14815130-14815152 GCTTTGACTCAGAGTGATGTGGG - Intergenic
950916066 3:16646530-16646552 GCTTTTATTCAGAGAAAAATGGG + Intronic
952352497 3:32553630-32553652 GCTTCTGTAGAGAGGGAAGTGGG - Intronic
953034935 3:39203218-39203240 GATTTTAATCAGGGGCAAGTTGG + Intergenic
955777137 3:62446051-62446073 ACTTTTTTTCAGAGGGAGGGAGG - Intronic
955888059 3:63621196-63621218 GATTTTATTCTAAGAGAAGTGGG + Intergenic
957496853 3:81004027-81004049 GCTTTTAGTGAAAGAGAAGTGGG + Intergenic
958679218 3:97305111-97305133 GCTTTTATTCAGATGTTTGTTGG - Intronic
959322066 3:104889180-104889202 TTTTTTATTCAGAGGAAACTGGG - Intergenic
960398063 3:117161420-117161442 GCTTTTTTTCTGTGGGGAGTGGG + Intergenic
960621679 3:119643004-119643026 GCTGTTATCCAGAGGGCAGGTGG + Intronic
962220917 3:133564165-133564187 GTTTTTATCCTGAGGGCAGTGGG + Intergenic
962731964 3:138291936-138291958 GCTTTTATTCAGAGTTTAATAGG + Intronic
964167425 3:153725490-153725512 GCTTTTACTCAGAGTGAGATGGG - Intergenic
964521143 3:157569326-157569348 GCTTTGATTCATACTGAAGTTGG - Intronic
965011143 3:163093621-163093643 GCTTTTATTCATAGTGAAAAAGG - Intergenic
965108269 3:164387294-164387316 GCATCTCTTCACAGGGAAGTAGG + Intergenic
965493214 3:169365704-169365726 GCTTATATTCAGAGAGGTGTGGG + Intronic
965537341 3:169836940-169836962 GCTTCTATTCAGAGAGAAATGGG + Intronic
967505507 3:190248653-190248675 GCATTTTTTCAGATGGTAGTTGG + Intergenic
968062378 3:195735420-195735442 GCTTTTCTTCTGAGTGAAATGGG - Intronic
969318277 4:6395174-6395196 ACCTTTATTCAAAGGGCAGTGGG - Intronic
970114656 4:12681155-12681177 GACTTTATTCAGAAGGAAGTAGG - Intergenic
970383384 4:15531189-15531211 GATTTGCTTCAGAGGAAAGTTGG - Intronic
970432394 4:16000997-16001019 GCTTGCGTTCAGAGAGAAGTCGG - Intronic
971528116 4:27648398-27648420 CCTTATATTAAGAGGGAATTTGG - Intergenic
972168966 4:36321790-36321812 GCCTTTATTCTGATGGAAGCTGG - Intronic
974026632 4:56738606-56738628 GCTTTTATTCTGAGGGCAACAGG + Intergenic
975107397 4:70582936-70582958 GCTTTTATTCTGAGTGAAGTAGG - Intergenic
975468880 4:74741339-74741361 TCTTTTATTCAGACAGATGTAGG - Intergenic
975478158 4:74846416-74846438 GCTTCTACTCAGAGTGAATTGGG - Intergenic
977112573 4:92977526-92977548 GATTTTATTCAGTGTGAAATGGG + Intronic
977463914 4:97359310-97359332 GCTTTTAATCTGAGTGAGGTGGG - Intronic
979243484 4:118471116-118471138 ACTTTTATTCTGAGTGAAATGGG + Intergenic
979933456 4:126662086-126662108 GCTTTTGTTCAGATGTAATTTGG - Intergenic
980556923 4:134419599-134419621 GTTTATATTAAGAGGGCAGTCGG - Intergenic
980854353 4:138421532-138421554 GACTTTATGCAGAGGGAAGTGGG + Intergenic
980939712 4:139261769-139261791 TCTCTTATTAAGAGGGAGGTCGG - Intergenic
981937910 4:150254256-150254278 GCCTTGTTTCAGGGGGAAGTTGG + Intronic
982147717 4:152415643-152415665 GCTTTTACTCTGAGTGAAATGGG - Intronic
982429564 4:155306972-155306994 GCTTTTAATGATAGGAAAGTAGG + Intergenic
983191606 4:164760213-164760235 GCTTTTAATCTGAGTGAAATAGG + Intergenic
983556209 4:169061361-169061383 GAATTTTTTCAGAGGGAAGATGG - Intergenic
983985453 4:174053974-174053996 GGTTTTACTCTGAGAGAAGTGGG + Intergenic
984003841 4:174284309-174284331 GCTTTTAGTCACAACGAAGTGGG + Intronic
984499226 4:180537171-180537193 GCTTCTAACCAGAGAGAAGTTGG + Intergenic
988183245 5:27825514-27825536 GCTGTTGTTCAGAGGAAACTAGG + Intergenic
988967489 5:36433897-36433919 GGTTTTATTCTGAGTGAGGTGGG - Intergenic
988992229 5:36682713-36682735 GATTTTAGTCAGTCGGAAGTGGG + Intronic
989286122 5:39701953-39701975 TCTTTACTTGAGAGGGAAGTAGG + Intergenic
990804144 5:59639001-59639023 GCTTTTGTTTGGTGGGAAGTAGG + Intronic
996525192 5:124472255-124472277 GCTTTTATTTAGAAGGGAGTTGG + Intergenic
997228181 5:132225278-132225300 ACTATTATGCAGATGGAAGTTGG - Intronic
997492596 5:134290629-134290651 GCTTTTACTCTGAGTGAAGTGGG + Intronic
997741714 5:136260648-136260670 GCTGTCATTCTGAGGGAAATGGG + Intronic
997859523 5:137403856-137403878 GCTTTTCCTCTGAGGGAAATGGG + Intronic
998907175 5:146918423-146918445 GCATTTATTGAGAGGTAAATAGG + Intronic
999176488 5:149635421-149635443 GATTTTATTCTGAGGGCAGTGGG + Intergenic
999400201 5:151258521-151258543 GCTTTTATAGATAGGGAAGTGGG + Intronic
1003155598 6:3590890-3590912 GGTTTTACTCTGAAGGAAGTGGG + Intergenic
1004490468 6:16110199-16110221 GCTTTTATTCTGAGCGAGGCAGG + Intergenic
1005049691 6:21673373-21673395 GATTTTATACCGAGGGAGGTGGG + Intergenic
1005207001 6:23415949-23415971 GGTTTTATTTAGAGGGAAACGGG + Intergenic
1005484035 6:26282597-26282619 GCTTTTATTCCTAGTGAGGTGGG - Intergenic
1006881117 6:37340936-37340958 GATTTTATTCAGGAGGAAGAGGG - Intergenic
1008327976 6:50208582-50208604 AGTTGTATTTAGAGGGAAGTAGG - Intergenic
1008721373 6:54357892-54357914 GCTTTTAATCTGATGGAATTGGG - Intronic
1009296133 6:61950334-61950356 GCATCTGTTCAGAAGGAAGTTGG - Intronic
1009299816 6:62002520-62002542 GCTGTTATTTAGAGAGATGTGGG - Intronic
1010170927 6:72974550-72974572 GCTTCTATTTAGAGAGTAGTGGG - Intronic
1010330268 6:74615471-74615493 GCTTGTACTAAGAGGGAATTGGG + Intergenic
1010655821 6:78509398-78509420 ACTTTTTTACAGAAGGAAGTAGG + Intergenic
1010706087 6:79112525-79112547 ATTTTTATTGAGAGTGAAGTAGG - Intergenic
1011260204 6:85462301-85462323 GCTTTCATTTTGAGGGAAGTGGG - Intronic
1011572054 6:88748229-88748251 GCTCATACTCTGAGGGAAGTAGG - Intronic
1012477932 6:99635510-99635532 GCTTTGATACAGAGGGGTGTAGG + Intergenic
1012779295 6:103536276-103536298 GCTTTTCTCCAGAGGGGAGAGGG - Intergenic
1013526526 6:110979544-110979566 GGTTTTATTAAGAGGGAGTTAGG + Intergenic
1013644924 6:112127604-112127626 GCTTTTACTCGGAGTGTAGTCGG + Intronic
1014289017 6:119536914-119536936 GGTACTATTCAGAGGAAAGTAGG - Intergenic
1014473287 6:121842315-121842337 GCTTTTATCCTGAAGGCAGTAGG - Intergenic
1015029922 6:128582616-128582638 TCTTTTTTGCAGAGGCAAGTAGG - Intergenic
1015730566 6:136342974-136342996 GCTTTTATTAAAAGAGAAATTGG - Intronic
1016722403 6:147316888-147316910 GCTTTTATACAGAGATAAATTGG + Intronic
1017632958 6:156416601-156416623 GCTTTTATTCCAAGTGAAATGGG + Intergenic
1017993356 6:159509525-159509547 TCTTTTTTTCAGAGGCATGTAGG - Intergenic
1019208057 6:170379028-170379050 GCGTTTATGCTGAGGGAAATGGG + Intronic
1019900708 7:4018744-4018766 GCTTTTATTCAGTTGGCAGTGGG + Intronic
1020497072 7:8868308-8868330 GGTTTTAATCACAGGGAATTTGG - Intergenic
1021165016 7:17327400-17327422 GCTTTTTTTTAGAGGGAAACAGG - Intronic
1021439420 7:20661158-20661180 GCTTTTACTTAGAGTGAGGTGGG - Intronic
1021626555 7:22599146-22599168 GCTTTTATTTAGAAGGCAATCGG + Intronic
1022144614 7:27524622-27524644 GCTTTTATTCTGAGCAAAATGGG - Intergenic
1022633594 7:32109786-32109808 TCTTTTCTTTAGAGGGAAGAGGG + Intronic
1023361337 7:39418792-39418814 GCTTTGCTTCAGAGGAAAGCTGG - Intronic
1024254936 7:47533478-47533500 GATGTTAATCAAAGGGAAGTTGG + Intronic
1024623069 7:51179827-51179849 GCTTTTATTCTGCTTGAAGTTGG - Intronic
1024681770 7:51697612-51697634 CCTTTCAGTCAGAGTGAAGTAGG - Intergenic
1025910014 7:65820669-65820691 GCTTTTATTCTGACTGAAATGGG + Intergenic
1026337867 7:69410392-69410414 GCTTTTACTCTGAGTGAAATGGG - Intergenic
1027733829 7:81907608-81907630 GCTTGTATGCAGAAGGGAGTTGG - Intergenic
1027771138 7:82407956-82407978 TATTTTATTCTGATGGAAGTTGG - Intronic
1028399362 7:90407993-90408015 GATTTTATTCTGTGGGAAATGGG + Intronic
1029380228 7:100209496-100209518 GCTTTTACTCTGAGTGCAGTAGG + Intronic
1029434537 7:100555129-100555151 GGTTCTCTTCAGAGGGAAATGGG - Intronic
1031562431 7:123254744-123254766 GCTTTTATTCTGAGTGAAAGTGG - Intergenic
1036113987 8:5937941-5937963 GCTTTAATTCAAAGGTCAGTGGG + Intergenic
1036222891 8:6935378-6935400 ACTTTAATTAAGAGGGAAATGGG - Intergenic
1036228130 8:6977206-6977228 ACTTTCATTCAGAGGGAAATGGG - Intergenic
1036230583 8:6996323-6996345 ACTTTCATTCAGAGGGAAATGGG - Intergenic
1036233030 8:7015426-7015448 ACTTTCATTCAGAGGGAAATGGG - Intronic
1037929412 8:22868945-22868967 GCTTTTGCTCAGAGAGAAATGGG - Intronic
1038828990 8:31035578-31035600 GCTTTCATTCTGAGGGAGATGGG + Intronic
1039315628 8:36368566-36368588 GCTTTTATTTTGAAGGATGTAGG - Intergenic
1039834449 8:41245741-41245763 GCTTTTACTCTGAAGGAAGGTGG - Intergenic
1041389509 8:57336379-57336401 GTGTTTCTTCAGAGGGAACTGGG - Intergenic
1041979826 8:63844827-63844849 GCTTTTATTCTAAGGGAGATAGG - Intergenic
1042061838 8:64826767-64826789 GCTTTCCTTCAAAGGAAAGTTGG + Intergenic
1043730707 8:83676652-83676674 GCTTTTTTTCATATGGTAGTTGG + Intergenic
1044251585 8:90009073-90009095 GCTTTTACTCTGAGGCAAGTGGG - Intronic
1044708995 8:95037286-95037308 GCTCTGATTCAGAAGGAAATCGG - Intronic
1045716420 8:105051723-105051745 GTTTTGGTTCAGAGGGATGTGGG + Intronic
1046527946 8:115405295-115405317 GCTTTTATTCTGTCTGAAGTAGG - Intergenic
1048202007 8:132382419-132382441 GCTTTTACTCATGCGGAAGTGGG - Intronic
1048392200 8:133978345-133978367 GCATTTGTTCTGGGGGAAGTAGG + Intergenic
1051250639 9:15155133-15155155 GCTTTTATCCAGTAGGAAGAAGG - Intergenic
1053026064 9:34729393-34729415 ACTTTTGTTCTGTGGGAAGTTGG - Exonic
1054944674 9:70783428-70783450 GCATTTGCTCAGTGGGAAGTTGG + Intronic
1057476376 9:95406307-95406329 GCTTTTAATCATAAGCAAGTAGG + Intergenic
1058345900 9:103961881-103961903 GCCCTTAATCAGAGGGAAGGTGG - Intergenic
1058720238 9:107757810-107757832 GGTTTTATTTAGTGGGAAATGGG - Intergenic
1062139803 9:134949727-134949749 GCTGTCATTCAGGGGGGAGTGGG - Intergenic
1187170223 X:16843876-16843898 GTTTTTATTCACAGGGTAATGGG - Exonic
1188054602 X:25526536-25526558 GCAGTTATTCAGAGGATAGTTGG + Intergenic
1192055151 X:67766359-67766381 GCTTTTATTCTGAATGAAGTGGG - Intergenic
1192789200 X:74364654-74364676 GCTTCTATACAGAGAGAGGTTGG - Intergenic
1194519706 X:94902883-94902905 GTTTTTATTCAAAGAGAATTGGG + Intergenic
1194922552 X:99784468-99784490 TATTTTATTCAGAGGGTAGAGGG + Intergenic
1196388141 X:115181241-115181263 GCTTTTATTCTGAGAGATGTGGG + Intronic
1197024789 X:121736247-121736269 GCTTTTATTCAACGTGCAGTGGG + Intergenic
1199444693 X:147908917-147908939 GCTTTTACTCTGAGAGATGTAGG + Intergenic
1199786075 X:151106106-151106128 GCTATTATTCTAAGTGAAGTAGG - Intergenic
1200945186 Y:8828452-8828474 CTTTTTATTCAGAAGCAAGTCGG + Intergenic
1201888222 Y:18910884-18910906 GCTTTTATTCATATGGTTGTTGG - Intergenic
1202254761 Y:22909422-22909444 CCTTCTATTCAGAGGGATGATGG + Intergenic
1202407752 Y:24543171-24543193 CCTTCTATTCAGAGGGATGATGG + Intergenic
1202463029 Y:25126910-25126932 CCTTCTATTCAGAGGGATGATGG - Intergenic