ID: 1169483497

View in Genome Browser
Species Human (GRCh38)
Location 20:6006436-6006458
Sequence GGCCAGCGGAACCACTGTTC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 55
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 50}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169483488_1169483497 10 Left 1169483488 20:6006403-6006425 CCGGCCGCTCTTGGCTTGCGGCT 0: 1
1: 0
2: 1
3: 11
4: 115
Right 1169483497 20:6006436-6006458 GGCCAGCGGAACCACTGTTCGGG 0: 1
1: 0
2: 0
3: 4
4: 50
1169483489_1169483497 6 Left 1169483489 20:6006407-6006429 CCGCTCTTGGCTTGCGGCTGCCC 0: 1
1: 0
2: 2
3: 19
4: 181
Right 1169483497 20:6006436-6006458 GGCCAGCGGAACCACTGTTCGGG 0: 1
1: 0
2: 0
3: 4
4: 50
1169483484_1169483497 30 Left 1169483484 20:6006383-6006405 CCGAACGCTGGAGGCTGCGTCCG 0: 1
1: 0
2: 0
3: 9
4: 66
Right 1169483497 20:6006436-6006458 GGCCAGCGGAACCACTGTTCGGG 0: 1
1: 0
2: 0
3: 4
4: 50

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169483497 Original CRISPR GGCCAGCGGAACCACTGTTC GGG Exonic
907318976 1:53590922-53590944 AGCCAGCGGAGCCTCTGCTCCGG - Intronic
914990765 1:152497838-152497860 GGCCAGCTGCATCTCTGTTCTGG + Intergenic
918656040 1:187027599-187027621 GGCCAGAGGCATCACTGCTCTGG - Intergenic
1064307993 10:14185975-14185997 GGCCAGAGGATCAACTGTGCAGG + Intronic
1067412131 10:46074362-46074384 AGCCAGCCGAACCACAGTGCTGG + Intergenic
1076431922 10:130410110-130410132 GGCCAGAGGAACGTGTGTTCTGG + Intergenic
1083414213 11:62514827-62514849 GGCCAGCAGAGCCAGTGTTCTGG - Intronic
1086516143 11:87615497-87615519 GGCCAGCAGACCCACATTTCAGG + Intergenic
1089418762 11:118315498-118315520 GGCCAGCGGGACCTGTATTCTGG + Exonic
1096243998 12:49974326-49974348 GGCCAGTTGAGACACTGTTCCGG - Exonic
1102180492 12:110909085-110909107 GGCCAGAGGAGCCACAGTTAGGG - Intergenic
1104986575 12:132600877-132600899 GGCCAGGGGAGCCACTGAACCGG - Intergenic
1106450065 13:29872938-29872960 GCCCAGCAGAAACACTGCTCTGG - Intergenic
1112342079 13:98561005-98561027 AGACAGCAGAACCACTGTCCTGG - Intronic
1112569185 13:100578508-100578530 AGCCAGCAGAACCAGGGTTCCGG - Intronic
1113503239 13:110794481-110794503 GGCCAGCGGCACCTCTGCTTGGG - Intergenic
1114081382 14:19203873-19203895 TGCCAGTGGATCCACTATTCTGG - Intergenic
1115010637 14:28540583-28540605 GGTCAGTGGATCCACTGTTCTGG - Intergenic
1117571698 14:57055418-57055440 GGCCAGAGGAACAACTGCCCAGG - Intergenic
1121634721 14:95446150-95446172 AGCCAGGGGCACAACTGTTCTGG + Intronic
1122308292 14:100779199-100779221 GAGCAGCGGAGCCACTGTGCTGG - Intergenic
1130126131 15:81095579-81095601 GGGCACCAGAACCACTGTGCAGG - Intronic
1132761103 16:1509045-1509067 GGCCAGTGGAGCCACTGATGGGG + Intronic
1133005697 16:2880377-2880399 GGCCAGCAGCACCCCTGTTCAGG - Intergenic
1144950736 17:18992187-18992209 GGCCGGCGGATCCACTGGGCAGG - Intronic
1152718404 17:81910922-81910944 GGCCAGGGGAACCCCTGGACCGG + Intronic
1163561144 19:18020390-18020412 GCCCAGCCGGGCCACTGTTCAGG + Intergenic
939281293 2:140068830-140068852 GGCCAGCTGAAGTACTGGTCAGG + Intergenic
1169483497 20:6006436-6006458 GGCCAGCGGAACCACTGTTCGGG + Exonic
1173090328 20:39964533-39964555 GGGCAGCTGAACCATAGTTCAGG + Intergenic
1179298576 21:40086282-40086304 GGCCATCATAACCACTGCTCCGG + Intronic
1180499392 22:15918813-15918835 TGCCAGTGGATCCACTATTCTGG + Intergenic
1184152490 22:42646930-42646952 AGGCAGGGGAACCACAGTTCAGG + Intronic
961751074 3:129095251-129095273 GCCCAGTGGAACCACAGCTCTGG - Intronic
961827774 3:129607560-129607582 GGCCAGAGGGACCAGTGCTCAGG + Intergenic
968709995 4:2107651-2107673 GGCCAGGGGGACCACTGGCCTGG + Intronic
968949687 4:3684096-3684118 GGCCAGAGGCACCCCTGCTCCGG + Intergenic
969116095 4:4871678-4871700 GGCCAGCTGAACCTCAGTTGTGG + Intergenic
969316612 4:6385261-6385283 GGCCAGAGGAAGCAGTGCTCAGG - Intronic
980661102 4:135859243-135859265 GGCCAGAGGACACACTGTGCTGG - Intergenic
982413055 4:155101081-155101103 GGCCAGAGGATCAACTTTTCAGG + Intergenic
1003124573 6:3346202-3346224 GGCCAGCGCCACCTCTGCTCGGG + Intronic
1014392083 6:120874769-120874791 GGCCAGCGGCACCTCTGCTCAGG - Intergenic
1021993063 7:26154881-26154903 GGCCAGCCAAACCACTGTGGAGG + Intronic
1024415478 7:49100366-49100388 TGCCAGTGTAACCCCTGTTCAGG - Intergenic
1026928571 7:74210373-74210395 GGCCAGGGCAGCCACTGTTTTGG - Intronic
1032467133 7:132153185-132153207 GGCCAGGGGGACAAGTGTTCTGG + Intronic
1032934720 7:136715265-136715287 GCCCAGAGGAATCCCTGTTCTGG + Intergenic
1035901944 8:3466272-3466294 GGGCAGCAGAACCAGTATTCAGG + Intronic
1038584554 8:28777298-28777320 GGGCCACGGAACCACTGTGCTGG - Intronic
1038585349 8:28783419-28783441 GGCCAAAGGAAGCACTGCTCTGG + Intronic
1041170954 8:55141537-55141559 GGCCAGGGGAACCCCAGTGCAGG + Intronic
1041462704 8:58129527-58129549 GGCCAAGGGAACCACTGGACAGG - Intronic
1056809585 9:89753936-89753958 GGCCAGCTGAACGAATGTGCTGG - Intergenic
1061945259 9:133905132-133905154 GCCCGGCTGAGCCACTGTTCTGG - Intronic