ID: 1169483523

View in Genome Browser
Species Human (GRCh38)
Location 20:6006513-6006535
Sequence CCGGGCCCCACTGGCCGCCC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 471
Summary {0: 1, 1: 0, 2: 1, 3: 53, 4: 416}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169483523_1169483536 13 Left 1169483523 20:6006513-6006535 CCCGGGCGGCCAGTGGGGCCCGG 0: 1
1: 0
2: 1
3: 53
4: 416
Right 1169483536 20:6006549-6006571 CCTGGTACGTACCGATGAGGCGG 0: 1
1: 0
2: 1
3: 2
4: 30
1169483523_1169483534 10 Left 1169483523 20:6006513-6006535 CCCGGGCGGCCAGTGGGGCCCGG 0: 1
1: 0
2: 1
3: 53
4: 416
Right 1169483534 20:6006546-6006568 CAGCCTGGTACGTACCGATGAGG 0: 1
1: 0
2: 1
3: 1
4: 19
1169483523_1169483539 20 Left 1169483523 20:6006513-6006535 CCCGGGCGGCCAGTGGGGCCCGG 0: 1
1: 0
2: 1
3: 53
4: 416
Right 1169483539 20:6006556-6006578 CGTACCGATGAGGCGGCGGCGGG 0: 1
1: 0
2: 0
3: 1
4: 48
1169483523_1169483528 -5 Left 1169483523 20:6006513-6006535 CCCGGGCGGCCAGTGGGGCCCGG 0: 1
1: 0
2: 1
3: 53
4: 416
Right 1169483528 20:6006531-6006553 CCCGGCGAGCACCCCCAGCCTGG 0: 1
1: 0
2: 1
3: 38
4: 1227
1169483523_1169483538 19 Left 1169483523 20:6006513-6006535 CCCGGGCGGCCAGTGGGGCCCGG 0: 1
1: 0
2: 1
3: 53
4: 416
Right 1169483538 20:6006555-6006577 ACGTACCGATGAGGCGGCGGCGG 0: 1
1: 0
2: 1
3: 1
4: 45
1169483523_1169483542 30 Left 1169483523 20:6006513-6006535 CCCGGGCGGCCAGTGGGGCCCGG 0: 1
1: 0
2: 1
3: 53
4: 416
Right 1169483542 20:6006566-6006588 AGGCGGCGGCGGGCCGGCCCTGG 0: 1
1: 0
2: 5
3: 91
4: 732
1169483523_1169483537 16 Left 1169483523 20:6006513-6006535 CCCGGGCGGCCAGTGGGGCCCGG 0: 1
1: 0
2: 1
3: 53
4: 416
Right 1169483537 20:6006552-6006574 GGTACGTACCGATGAGGCGGCGG 0: 1
1: 0
2: 0
3: 3
4: 34
1169483523_1169483541 24 Left 1169483523 20:6006513-6006535 CCCGGGCGGCCAGTGGGGCCCGG 0: 1
1: 0
2: 1
3: 53
4: 416
Right 1169483541 20:6006560-6006582 CCGATGAGGCGGCGGCGGGCCGG 0: 1
1: 0
2: 1
3: 21
4: 293

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169483523 Original CRISPR CCGGGCCCCACTGGCCGCCC GGG (reversed) Exonic