ID: 1169483523

View in Genome Browser
Species Human (GRCh38)
Location 20:6006513-6006535
Sequence CCGGGCCCCACTGGCCGCCC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 471
Summary {0: 1, 1: 0, 2: 1, 3: 53, 4: 416}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169483523_1169483538 19 Left 1169483523 20:6006513-6006535 CCCGGGCGGCCAGTGGGGCCCGG 0: 1
1: 0
2: 1
3: 53
4: 416
Right 1169483538 20:6006555-6006577 ACGTACCGATGAGGCGGCGGCGG 0: 1
1: 0
2: 1
3: 1
4: 45
1169483523_1169483542 30 Left 1169483523 20:6006513-6006535 CCCGGGCGGCCAGTGGGGCCCGG 0: 1
1: 0
2: 1
3: 53
4: 416
Right 1169483542 20:6006566-6006588 AGGCGGCGGCGGGCCGGCCCTGG 0: 1
1: 0
2: 5
3: 91
4: 732
1169483523_1169483534 10 Left 1169483523 20:6006513-6006535 CCCGGGCGGCCAGTGGGGCCCGG 0: 1
1: 0
2: 1
3: 53
4: 416
Right 1169483534 20:6006546-6006568 CAGCCTGGTACGTACCGATGAGG 0: 1
1: 0
2: 1
3: 1
4: 19
1169483523_1169483536 13 Left 1169483523 20:6006513-6006535 CCCGGGCGGCCAGTGGGGCCCGG 0: 1
1: 0
2: 1
3: 53
4: 416
Right 1169483536 20:6006549-6006571 CCTGGTACGTACCGATGAGGCGG 0: 1
1: 0
2: 1
3: 2
4: 30
1169483523_1169483528 -5 Left 1169483523 20:6006513-6006535 CCCGGGCGGCCAGTGGGGCCCGG 0: 1
1: 0
2: 1
3: 53
4: 416
Right 1169483528 20:6006531-6006553 CCCGGCGAGCACCCCCAGCCTGG 0: 1
1: 0
2: 1
3: 38
4: 1227
1169483523_1169483537 16 Left 1169483523 20:6006513-6006535 CCCGGGCGGCCAGTGGGGCCCGG 0: 1
1: 0
2: 1
3: 53
4: 416
Right 1169483537 20:6006552-6006574 GGTACGTACCGATGAGGCGGCGG 0: 1
1: 0
2: 0
3: 3
4: 34
1169483523_1169483539 20 Left 1169483523 20:6006513-6006535 CCCGGGCGGCCAGTGGGGCCCGG 0: 1
1: 0
2: 1
3: 53
4: 416
Right 1169483539 20:6006556-6006578 CGTACCGATGAGGCGGCGGCGGG 0: 1
1: 0
2: 0
3: 1
4: 48
1169483523_1169483541 24 Left 1169483523 20:6006513-6006535 CCCGGGCGGCCAGTGGGGCCCGG 0: 1
1: 0
2: 1
3: 53
4: 416
Right 1169483541 20:6006560-6006582 CCGATGAGGCGGCGGCGGGCCGG 0: 1
1: 0
2: 1
3: 21
4: 293

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169483523 Original CRISPR CCGGGCCCCACTGGCCGCCC GGG (reversed) Exonic
900291008 1:1923597-1923619 CAGGGCCCCACGGGGCCCCCAGG - Intronic
900341263 1:2190431-2190453 CCCGGCCCCACTGGATGCCCAGG - Intronic
900365159 1:2309003-2309025 CCGGGTCCCACTGACCGCACGGG - Exonic
900389812 1:2428994-2429016 CCCGGCACCTCTGGCAGCCCTGG - Intronic
900796657 1:4712286-4712308 CGGGGCCCCACCGGCCACCGCGG - Exonic
901038868 1:6352265-6352287 CTGGGACTCACTGGCTGCCCTGG - Intronic
901075792 1:6554138-6554160 CCGGGGCCCACGGGCCGCACCGG + Exonic
901320246 1:8335639-8335661 TCTCGCCCCACTGGCCTCCCAGG + Intronic
901400888 1:9014573-9014595 CCTGGCCCCACTGCCAGGCCAGG + Intronic
901836355 1:11926310-11926332 CCGCGCCTCACTGCCCGGCCCGG + Exonic
903339910 1:22647322-22647344 CCGGGCACCCCTGGCATCCCAGG - Exonic
903461149 1:23521807-23521829 GAGGGTACCACTGGCCGCCCAGG + Intronic
903576464 1:24342516-24342538 CCAGGCCCCACTGGCCAGGCTGG + Intronic
903925173 1:26826759-26826781 CCGCGCCCCGCGGGCCGGCCGGG - Exonic
904162276 1:28530692-28530714 CTGGGCGCCATTGGCTGCCCGGG + Intronic
904597943 1:31658495-31658517 CCCGGCCCCCCTGGACACCCTGG - Exonic
904598438 1:31661073-31661095 CCTGGCAGCACTGGCCGGCCTGG - Exonic
904603168 1:31684575-31684597 CCGGGCACCACAGGGCGGCCAGG - Exonic
904876566 1:33659364-33659386 CCGGGCCCCGCTGTCAGCTCTGG - Intronic
905169021 1:36098986-36099008 CCCGGCCCCCCCGGCCTCCCTGG - Exonic
905169107 1:36099187-36099209 CCAGGACCCCCTGGCCTCCCGGG - Exonic
905169187 1:36099388-36099410 CCTGGCCCCCCTGGCTTCCCAGG - Exonic
905169192 1:36099397-36099419 CGGGGTCCCCCTGGCCCCCCTGG - Exonic
907012705 1:50978145-50978167 CCGGGGTCGCCTGGCCGCCCGGG - Intergenic
907288146 1:53395431-53395453 CTGGGCCCCACTGGCTGCCACGG + Intergenic
908682873 1:66682117-66682139 CCAGGTCCCACAGGCCCCCCAGG + Exonic
909001412 1:70221673-70221695 CCGGGCCCCAGCGGCGGGCCCGG + Exonic
910760490 1:90727135-90727157 CCAGGCCCCAAGGACCGCCCCGG + Intergenic
911865623 1:103017836-103017858 CAAGGCCCCACTGGACCCCCTGG - Exonic
912718507 1:112000250-112000272 CAGGGCTCCACTTGCCTCCCTGG - Intergenic
912879118 1:113390932-113390954 CCGGGCTGCGCGGGCCGCCCAGG + Intronic
914689175 1:150010478-150010500 CCGGGCCCCGCGCTCCGCCCCGG - Exonic
914753180 1:150549408-150549430 AGGGGCCCCAGTGGCCGCCGCGG + Exonic
918038448 1:180897471-180897493 CCTGAGCCCACTGGCCCCCCAGG + Intergenic
919451336 1:197775599-197775621 CCTGCACCCTCTGGCCGCCCGGG - Intronic
922335834 1:224617481-224617503 CAGGGCCCGACTGGGCGTCCCGG + Intronic
922741105 1:228014696-228014718 CCGGGCCACGCTGGCCTCCCCGG - Intronic
923673964 1:236064736-236064758 CCCGGACCCGCTGGCCGCCGGGG - Intronic
923678627 1:236101181-236101203 CCGGGCCCCTGAGGCCGCCCTGG + Intergenic
924172604 1:241357321-241357343 CCGGGCCTCCCGGGCCTCCCCGG + Intergenic
1063593124 10:7410893-7410915 CCAGGCCCCGGTCGCCGCCCGGG + Intronic
1063660960 10:8034889-8034911 CCCGGCCGCGCTGGCAGCCCTGG - Intergenic
1065614272 10:27504330-27504352 CCGAGCCCAGCTGGCCGCCCGGG - Exonic
1065807610 10:29409578-29409600 CCGAGCCCAGCTGGCCGCCCGGG - Intergenic
1066064218 10:31750511-31750533 CCGGGGCCCAGCGGCTGCCCAGG - Intergenic
1066754415 10:38696384-38696406 CTTAGCCCCACTGGCCACCCTGG - Intergenic
1067142347 10:43667980-43668002 CGGGGCCCCTCCGGCCGCCCCGG - Intergenic
1069486506 10:68827354-68827376 CCGGGCCCAACTCGGCCCCCTGG - Intergenic
1070257381 10:74824725-74824747 GGGGGCTCCTCTGGCCGCCCAGG - Intergenic
1070877289 10:79826082-79826104 CCCGGCCCCGCCGCCCGCCCCGG + Intergenic
1071643786 10:87342126-87342148 CCCGGCCCCGCCGCCCGCCCCGG + Intergenic
1072891614 10:99329751-99329773 GCGGTCCCCACTCGCCCCCCGGG + Exonic
1073326333 10:102645751-102645773 CGGGGCCTCGCTGGCTGCCCAGG - Intronic
1073510623 10:104040368-104040390 CCAGGCCCACCTGGCCCCCCAGG - Exonic
1075519708 10:123136259-123136281 CAGGGCCCCCTTGGCCGCCGCGG - Exonic
1075777230 10:124996785-124996807 CCGGGCCCCACTGGGCCTCATGG - Intronic
1076706786 10:132306864-132306886 CCGGGGCCCCCTGGCACCCCGGG + Intronic
1076736925 10:132463104-132463126 CCGATCCCCACTGGCCACGCCGG - Intergenic
1076789753 10:132770560-132770582 CAGAGCCTCGCTGGCCGCCCCGG + Intronic
1076815216 10:132911239-132911261 CCGGCCCACACTGACTGCCCAGG + Intronic
1076948186 10:133665619-133665641 CCGGGCCCCTGCAGCCGCCCAGG + Intergenic
1076949175 10:133668929-133668951 CCGGGCCCCTGCAGCCGCCCAGG + Intronic
1076950159 10:133672228-133672250 CCGGGCCCCTGCAGCCGCCCAGG + Intergenic
1076951144 10:133675527-133675549 CCGGGCCCCTGCAGCCGCCCAGG + Intergenic
1076952134 10:133678837-133678859 CCGGGCCCCTGCAGCCGCCCAGG + Intergenic
1076953122 10:133682147-133682169 CCGGGCCCCTGCAGCCGCCCAGG + Intergenic
1076954106 10:133685446-133685468 CCGGGCCCCTGCAGCCGCCCAGG + Intergenic
1076955090 10:133741798-133741820 CCGGGCCCCTGCAGCCGCCCAGG + Intergenic
1076956080 10:133745108-133745130 CCGGGCCCCTGCAGCCGCCCAGG + Intergenic
1076958057 10:133751727-133751749 CCGGGCCCCTGCAGCCGCCCAGG + Intergenic
1076959041 10:133755026-133755048 CCGGGCCCCTGCAGCCGCCCAGG + Intergenic
1076960030 10:133758336-133758358 CCGGGCCCCTGCAGCCGCCCAGG + Intergenic
1076961014 10:133761635-133761657 CCGGGCCCCTGCAGCCGCCCAGG + Intergenic
1076984091 11:223062-223084 CTGGGCCCCTGTGGCTGCCCTGG + Intronic
1077364222 11:2155066-2155088 GCGGGCCCCACATTCCGCCCAGG - Intronic
1077372518 11:2190098-2190120 CAGTGCCCCCCTGGCCTCCCGGG - Intergenic
1077491520 11:2862969-2862991 CCGGGACCCCCTGCCCGGCCCGG + Intergenic
1077539155 11:3138566-3138588 CCAGGCTCCACTGGGGGCCCAGG - Intronic
1079079069 11:17401455-17401477 CCAGGCCCCTCTGCCCACCCTGG - Intronic
1081465424 11:43312209-43312231 CCAGGCCCTGCAGGCCGCCCGGG - Intronic
1081699984 11:45146825-45146847 CCGGGCCGCTCTCGCCGCCCGGG + Intronic
1083151077 11:60792148-60792170 CCCTGCCCCACTGGCCGCCAAGG + Intronic
1083227864 11:61295709-61295731 CCGGGCTCCTCTGGGCACCCAGG + Intergenic
1083301830 11:61743679-61743701 GCGGGCACCACTGGCCACCATGG + Exonic
1083340353 11:61955225-61955247 CCGGGTCCCTGTGGCCGCCCAGG + Intronic
1083437068 11:62649803-62649825 CCGGGCCCACCTGGCTGCCCTGG - Exonic
1083478242 11:62927311-62927333 CCGGGCCCCCCTCCCAGCCCAGG - Intergenic
1083571939 11:63765751-63765773 CTGTGCCCCACTGGCCACCCAGG + Intronic
1083605966 11:63979126-63979148 CTGGGCCCCACAGGCTTCCCTGG - Intronic
1083928376 11:65823426-65823448 CCAGGCCCCACTGGCCTGCCTGG - Intronic
1084010923 11:66347814-66347836 CCGGGCCCCGCCGGCTTCCCGGG + Intergenic
1084212088 11:67629026-67629048 CCGGGTCGCACTTGCCGCCTGGG + Exonic
1084859007 11:72006039-72006061 AGGGGCCCCACTGGACACCCCGG + Exonic
1085011057 11:73142103-73142125 CCGGGCCGCCCGGGCCGCCCGGG - Exonic
1087014502 11:93542873-93542895 CGGGGCCCTCCCGGCCGCCCCGG + Intronic
1089610182 11:119664592-119664614 CTGGGCTCCCCTGGCCCCCCAGG + Exonic
1089674386 11:120080101-120080123 CCTTGCCCCACTGCCCTCCCTGG - Intergenic
1090799782 11:130163160-130163182 CAGGGCCCCACTGACAGCCTGGG - Intronic
1091280015 11:134376415-134376437 TTGGGCCCCACTTGCCGCCTGGG + Intronic
1091434320 12:460864-460886 CCGGGCCCCTCCAGCCGCTCCGG + Intronic
1092166951 12:6348211-6348233 ACAGGCTCCACTGGCTGCCCAGG + Exonic
1092778128 12:11961863-11961885 CCGTGCAGCACTGGCCACCCAGG + Intergenic
1095983495 12:47985568-47985590 AAGGGTCTCACTGGCCGCCCTGG - Exonic
1095985611 12:47997616-47997638 CCCGGCCCCCCTGGTCCCCCTGG - Exonic
1096116850 12:49060105-49060127 CCGAGCCCCTCTCCCCGCCCCGG + Intergenic
1096215016 12:49793782-49793804 CCGGGGCCCACAGGCTGGCCAGG + Exonic
1096259279 12:50081064-50081086 CCTGACCCCACTGACCCCCCTGG + Intronic
1096389287 12:51217108-51217130 CCGGGTCCCACCGGTCGTCCCGG + Intronic
1096689304 12:53309637-53309659 CCGCCCCCCACTGGGGGCCCAGG + Exonic
1097251222 12:57633084-57633106 CCGCGTCCCACTGGCAGCGCGGG + Exonic
1097288724 12:57896698-57896720 CCGGGCCCAGCCCGCCGCCCGGG + Intergenic
1101834069 12:108282760-108282782 CTGGGCCCCACGGGACCCCCAGG + Intergenic
1102472190 12:113165629-113165651 CCCGGCCCCACTCACCGCCCGGG + Exonic
1103362388 12:120361793-120361815 CCGGCTCCCCCTGGCCTCCCCGG + Intronic
1104081573 12:125434554-125434576 CCCAGCCTCAGTGGCCGCCCTGG + Intronic
1104719401 12:131036699-131036721 CCGGGCCTCACTCACCGCACCGG + Intronic
1104719594 12:131037959-131037981 CCGGGCCCCACTCACTGCACTGG + Intronic
1104945116 12:132412245-132412267 CCAGGCCCCACTGACATCCCAGG - Intergenic
1104945193 12:132412497-132412519 CCAGGCCCCACTGACATCCCAGG - Intergenic
1104945200 12:132412515-132412537 CCAGGCCCCACTGACACCCCAGG - Intergenic
1104945321 12:132412895-132412917 CCAGGCCCCACTGACACCCCAGG - Intergenic
1104945341 12:132412950-132412972 CCAGGCCCCACTGACACCCCAGG - Intergenic
1104945371 12:132413043-132413065 CCAGGCCCCACTGACATCCCAGG - Intergenic
1104945377 12:132413061-132413083 CCAGGCCCCACTGACATCCCAGG - Intergenic
1104945384 12:132413079-132413101 CCAGGCCCCACTGACACCCCAGG - Intergenic
1104945398 12:132413116-132413138 CCAGGCCCCACTGACATCCCAGG - Intergenic
1104945411 12:132413153-132413175 CCAGGCCCCACTGACATCCCAGG - Intergenic
1104945418 12:132413171-132413193 CCAGGCCCCACTGACACCCCAGG - Intergenic
1104945455 12:132413280-132413302 CCAGGCCCCACTGACACCCCAGG - Intergenic
1104945475 12:132413335-132413357 CCAGGCCCCACTGACACCCCAGG - Intergenic
1104945482 12:132413353-132413375 CCAGGCCCCACTGACACCCCAGG - Intergenic
1104945506 12:132413428-132413450 CCAGGCCCCACTGACATCCCAGG - Intergenic
1104945512 12:132413446-132413468 CCAGGCCCCACTGACATCCCAGG - Intergenic
1104945519 12:132413464-132413486 CCAGGCCCCACTGACACCCCAGG - Intergenic
1104945533 12:132413501-132413523 CCAGGCCCCACTGACATCCCAGG - Intergenic
1104945546 12:132413538-132413560 CCAGGCCCCACTGACATCCCAGG - Intergenic
1104945552 12:132413556-132413578 CCAGGCCCCACTGACATCCCAGG - Intergenic
1104945570 12:132413610-132413632 CCAGGCCCCACTGACATCCCAGG - Intergenic
1104983405 12:132583657-132583679 CCGGGCCCCCCACGCCCCCCGGG + Exonic
1105413741 13:20192537-20192559 CCCGGCCCCACTCGCACCCCGGG + Intronic
1105804909 13:23947114-23947136 CCAGTCCACACTGGCCACCCTGG + Intergenic
1106413236 13:29525305-29525327 CAGGGTCCCACTGGCTGGCCTGG + Intronic
1107468053 13:40666729-40666751 CCGGCGCCCACTGGCTGCCCGGG - Intergenic
1108373387 13:49792396-49792418 CTGGGCCCGCCTGGCCGCGCCGG - Intronic
1108727886 13:53201547-53201569 CCTGGCCACGGTGGCCGCCCTGG + Intergenic
1110706839 13:78607389-78607411 CCGGGCCCCACTTGCAGGCCCGG + Intergenic
1113420166 13:110164963-110164985 CCGGGTCCTCCTGGCCCCCCAGG - Exonic
1113461559 13:110485696-110485718 CCGGGCCTCCCAGGCAGCCCAGG - Exonic
1113768221 13:112894053-112894075 CCCCGCCCCGCTGCCCGCCCCGG + Intergenic
1113837527 13:113338153-113338175 CCGGGACCCATCGCCCGCCCGGG + Intronic
1113885799 13:113657866-113657888 CAGGGCCTCACTTGCCTCCCAGG - Intronic
1113888620 13:113724970-113724992 GAGGGCCCGACTGGCCGCCAGGG + Intronic
1113895854 13:113764221-113764243 CAAGGCCACACTGGCGGCCCAGG - Intronic
1115120214 14:29928377-29928399 CCAGGCCCCTCTGGGAGCCCTGG + Intronic
1115754090 14:36516714-36516736 CCGGCACCCTCTGGCCGCCTAGG - Exonic
1117135370 14:52730194-52730216 CCGTACCCCTCAGGCCGCCCAGG - Exonic
1118024076 14:61751198-61751220 CCGGGCCCCGCCCGCGGCCCCGG + Intergenic
1118627808 14:67674874-67674896 CCGGGCCCCGCCGGCCGGCGAGG + Intronic
1118976071 14:70677577-70677599 CCTGCCTCCACTGCCCGCCCTGG - Intergenic
1119702138 14:76762389-76762411 CGGGTGCCCACTGGGCGCCCTGG - Exonic
1121054173 14:90839411-90839433 CCAGGCCCCAAGGGCCACCCAGG + Intergenic
1121667873 14:95686350-95686372 CCCGCCCCCACTGCCGGCCCGGG + Intergenic
1122066348 14:99176400-99176422 GCGGGCCGCCCTGGCCACCCGGG + Intronic
1122150353 14:99722173-99722195 ACGGGCCTCACTGGCTGCCCTGG + Intronic
1122582315 14:102778098-102778120 CCGGGCCCCCCCGGCCGGCCCGG - Intronic
1122880870 14:104689906-104689928 CAGGGCGCCCCTGGCCCCCCCGG + Intronic
1122917255 14:104865017-104865039 CCAGGCCCCGCTGGCCTCCCCGG - Intergenic
1124807386 15:32899340-32899362 CTGCTCCCCACTGGCCTCCCGGG - Intronic
1129162263 15:73753256-73753278 CCCCGCCGGACTGGCCGCCCGGG + Intergenic
1131827452 15:96332282-96332304 CCGGGCCGCCAGGGCCGCCCTGG - Exonic
1132398260 15:101489623-101489645 CCGGGCCCCGGCCGCCGCCCCGG - Exonic
1132551677 16:556296-556318 CCGCTCCCCACTGGCCGGCCAGG + Intergenic
1132670875 16:1101887-1101909 CCGGACCCCTCTGGGTGCCCCGG - Intergenic
1132763004 16:1520076-1520098 CCGGGCTCCACAGCCCTCCCCGG + Intronic
1132975452 16:2709116-2709138 CCCAGCCCCACTGGCCGCGGCGG + Intergenic
1133017542 16:2951258-2951280 CCGGGAGCCCCTGGCCCCCCGGG + Intergenic
1133286747 16:4694252-4694274 CCGGGCCCCGCCCCCCGCCCCGG + Intronic
1134849727 16:17470439-17470461 CCGGGGGGCACTGCCCGCCCGGG - Exonic
1135326201 16:21527310-21527332 CAGGGCCCCTCTGGCCGCTTGGG + Intergenic
1135509419 16:23069269-23069291 CCGGGCCCCTCTGGCTGTCATGG - Exonic
1136497481 16:30653037-30653059 CCGGGCCCCCCAGCCCACCCTGG + Exonic
1136707776 16:32202916-32202938 CGGGGTCCCCCGGGCCGCCCGGG - Intergenic
1136728266 16:32380459-32380481 CTTAGCCCCACTGGCCACCCTGG + Intergenic
1136760133 16:32726495-32726517 CGGGGTCCCCCGGGCCGCCCGGG + Intergenic
1136807971 16:33143891-33143913 CGGGGTCCCCCGGGCCGCCCGGG - Intergenic
1137558780 16:49489889-49489911 CCTGGCCCTGCTGGCCTCCCAGG - Exonic
1138589747 16:57993343-57993365 CAGGGACCCATTGGCTGCCCTGG + Intergenic
1139637054 16:68264281-68264303 CCCGGCCACGCTCGCCGCCCTGG - Intergenic
1139637088 16:68264400-68264422 CCGGGCCCCCGTGGCCGCCACGG - Intergenic
1141527011 16:84618127-84618149 CCCGCGCCCATTGGCCGCCCAGG + Intergenic
1141972357 16:87492478-87492500 CCCGGCCGCCCCGGCCGCCCCGG - Intergenic
1142039247 16:87882037-87882059 CAGGGCCCCTCTGGCCGCTTGGG + Exonic
1142235676 16:88921475-88921497 GAGGGGCCCACTCGCCGCCCTGG - Intronic
1142260825 16:89041826-89041848 CCGGGCACCCCTAGCCTCCCTGG + Intergenic
1142373244 16:89694479-89694501 CTGGGCCCCGCAGGCCTCCCGGG - Intronic
1202998172 16_KI270728v1_random:137295-137317 CTTAGCCCCACTGGCCACCCTGG - Intergenic
1203062289 16_KI270728v1_random:986817-986839 CGGGGTCCCCCGGGCCGCCCGGG + Intergenic
1142492103 17:285987-286009 CCAGGCCCCACTGTGCACCCCGG + Intronic
1142592699 17:1013336-1013358 CCAGGCCCCTGTGGCCGCCGTGG + Intronic
1142742068 17:1937080-1937102 CCTGGCCCCGCTGGGGGCCCTGG - Exonic
1142812171 17:2400523-2400545 CCAGGCTCCGCAGGCCGCCCGGG + Intronic
1142902039 17:3018216-3018238 CTGGGACCCACTTGCCGCCCCGG - Intronic
1143026668 17:3945198-3945220 CTGGGGTCGACTGGCCGCCCGGG - Intronic
1143036796 17:4004121-4004143 CCTGGCCCCACCGCCCGCCGTGG - Intergenic
1143537372 17:7549291-7549313 CCGGGCATCGCTGTCCGCCCAGG + Exonic
1145191554 17:20844349-20844371 CGGGGTCCCCCGGGCCGCCCGGG - Intronic
1145957009 17:28861609-28861631 CAGGGCCCCACTGGGGGCACAGG + Intergenic
1146653504 17:34621723-34621745 CCTGGCTCCACTGGGCCCCCAGG - Intronic
1147139604 17:38453818-38453840 CCGGGGCCCGCCGGCCGCCCGGG + Intronic
1147331205 17:39700386-39700408 CCGGGCCCCTCTGGCCCCGCCGG - Intronic
1147383815 17:40070591-40070613 CTGGGCCACGGTGGCCGCCCCGG + Intronic
1147582046 17:41632386-41632408 CCTGGCTCCCCTGGCCCCCCTGG + Intergenic
1147934086 17:44001611-44001633 CTGGGCCCCATTGGCTGCCTGGG + Intronic
1148793629 17:50187049-50187071 CCTGGCCCCATTGGGCCCCCTGG - Exonic
1148795461 17:50194737-50194759 CCCGGACCCACTGGCCTGCCCGG - Exonic
1149678686 17:58488427-58488449 CGAGGCCCCATTGGCCGCGCTGG - Intergenic
1150540142 17:66088639-66088661 TGGGGCCCCAGTGGCCGACCTGG - Intronic
1150983447 17:70169314-70169336 CCGGGCCCGACTCCCCGGCCGGG + Intronic
1151173549 17:72268494-72268516 CTGAGCCCCACTGGAAGCCCAGG + Intergenic
1151670692 17:75570277-75570299 GCGGGCCCCACTCCCAGCCCCGG - Intronic
1151823019 17:76507231-76507253 CCGGGCCTCACTCTCCTCCCAGG - Intergenic
1152336620 17:79702810-79702832 CAGGGCCCCACTGGCCCACTAGG - Intergenic
1152455720 17:80415077-80415099 CCGGGCCGCACTTCCCACCCGGG - Intergenic
1152531883 17:80923581-80923603 CCGGGCACCACAGGCCCCGCTGG + Exonic
1152633349 17:81420495-81420517 CCGGGTCAGACTGGCCTCCCAGG + Intronic
1152987642 18:334816-334838 CCAGGCCCCAAGGGCCCCCCCGG - Exonic
1154314770 18:13296008-13296030 CAGGACCCCACCGGCAGCCCAGG + Intronic
1155054366 18:22171285-22171307 CGGGGCCCCGCTCTCCGCCCCGG - Exonic
1157403863 18:47407668-47407690 CTGGGCCCCTCAGGCCTCCCAGG - Intergenic
1157464203 18:47930530-47930552 CCGGGCCCGGCCGGCGGCCCGGG + Exonic
1160242038 18:77131789-77131811 CTGGGCCCCACTGCCTGTCCTGG - Intronic
1160585456 18:79911230-79911252 CAGGCCCCCACTGGCCCCTCAGG - Intronic
1160683283 19:422331-422353 CCGGGCCCCTGTGGCCCCCACGG - Exonic
1160732734 19:648620-648642 CAGGTCCCCTCTGGCAGCCCGGG - Intronic
1160736862 19:666966-666988 CCAGGCCCCACCGGCCACCCTGG + Intergenic
1160808920 19:1004623-1004645 CCGGGACCCACGGGGCGCCCCGG + Exonic
1160909777 19:1469152-1469174 CCGGGCCCCAGGGGCCGGGCGGG + Exonic
1160967901 19:1754540-1754562 CCGGGGCGCACGGGCCGCACGGG + Exonic
1161273220 19:3401638-3401660 CAGAGCCCCACGGGCCTCCCGGG - Intronic
1161696441 19:5771214-5771236 CCCAGCCCCACTGGCCCCCAGGG + Intronic
1162320545 19:9968709-9968731 CAGGGGCCCTCTGGCCTCCCAGG - Exonic
1162325510 19:9996670-9996692 CAGGGCCCTGCTGGCCTCCCAGG - Exonic
1162396550 19:10420738-10420760 CCGGCCCCCACTTGCGCCCCAGG - Exonic
1162420826 19:10565343-10565365 CCTGGCCCCACTGTGCGGCCTGG - Intronic
1162512214 19:11126209-11126231 CCTGGCCTCACTGTCCTCCCTGG + Intronic
1162548104 19:11343155-11343177 TAGGGCCCCTCTGGCCTCCCAGG - Intronic
1162549501 19:11350813-11350835 CTGAGCCCCACAGGCCGCCAGGG + Exonic
1162572210 19:11480247-11480269 CCAGACCCCGCAGGCCGCCCAGG - Intronic
1162581872 19:11536225-11536247 CCGGCGCCCCCTGGCGGCCCGGG - Intergenic
1162612511 19:11767382-11767404 CAGGGCCGCAGTGGCCGCGCAGG - Intronic
1162698481 19:12495755-12495777 CCGGGCCTCAGTAGCCGCGCGGG - Intronic
1162911586 19:13850649-13850671 CCGGGCCCCTCCGGACGCCGAGG - Intergenic
1163062109 19:14768290-14768312 TCGGTCCCCACTGTCCACCCTGG - Intronic
1163065035 19:14786379-14786401 CCGGGCGCCTCAGGCCCCCCAGG - Intergenic
1163424684 19:17235059-17235081 CAGGCCCCCACTGGGCTCCCAGG - Intronic
1163692772 19:18746253-18746275 CCTGGCCCCACTGCCCTGCCAGG - Intronic
1164564228 19:29314618-29314640 CCAGCCCCCAGTGGCCTCCCAGG + Intergenic
1165623910 19:37269716-37269738 CCGGTCTCCAGTGGCCCCCCGGG - Intergenic
1166367200 19:42283896-42283918 CCCGCCCCCATTGGCCGCCCCGG - Intronic
1166823514 19:45595342-45595364 CCAGTCCCCACTGGCAGCCCAGG - Intronic
1166894455 19:46015275-46015297 CCGCGCCTCGCTGGCCGCCCCGG - Intronic
1166908999 19:46137655-46137677 CTGGGCCACACTGGCCGCATAGG - Intergenic
1167072822 19:47230641-47230663 CGGGGCCGCACTGGCCGCCAGGG + Intronic
1167076996 19:47256399-47256421 GCGGGGCCGACTGGCCCCCCGGG - Intronic
1167472292 19:49682074-49682096 CCGGCCCCGCCTGGCCACCCTGG - Intronic
1167498980 19:49835223-49835245 CCGGGCCCCACATGGCCCCCTGG + Intronic
1168199750 19:54805983-54806005 CCGGGCCCCACGGTTCGCGCAGG + Exonic
1168707936 19:58480271-58480293 CCTGCCCCCACTGTGCGCCCAGG + Exonic
925270839 2:2606329-2606351 CCTGGCCCCACTGTCCACACTGG - Intergenic
926114734 2:10205221-10205243 CCGAGCCCCACTCACCGCTCAGG - Intronic
926154820 2:10448050-10448072 CCGGGGCCCGCAGCCCGCCCCGG + Intronic
926683710 2:15682084-15682106 CCGGGCCCCACTGCCAACACTGG - Intergenic
927054386 2:19356035-19356057 CCGGACCCCGCTGGGCGCCGCGG + Intronic
927931801 2:27050188-27050210 CCGAACCCCCCGGGCCGCCCTGG - Intronic
929665642 2:43831904-43831926 CCTGGCCCCCCCGCCCGCCCCGG - Intronic
929877983 2:45813045-45813067 CCTGGCCCCGCTGGCGGCCCAGG + Intronic
930011521 2:46941400-46941422 CCGGGCCCCCGCTGCCGCCCGGG + Exonic
930096467 2:47570354-47570376 CCGGGCCCCGAGCGCCGCCCCGG - Exonic
932591476 2:73070651-73070673 CCGGGCCCAACCAGGCGCCCGGG + Intronic
933760039 2:85666742-85666764 ACGGCCCCCTCTGGCCTCCCAGG - Exonic
933876163 2:86623498-86623520 CCAGGCCCCGCCGACCGCCCAGG + Exonic
936452929 2:112646503-112646525 GGGTGCCCCACTGGCCCCCCAGG + Intronic
936938321 2:117859115-117859137 CCGGGTGCCACCGGCCGCCAGGG - Intergenic
937070115 2:119056874-119056896 CTGGTCTCCGCTGGCCGCCCCGG + Intergenic
937917490 2:127106232-127106254 CCCGGCCCCACCGGGAGCCCAGG - Intronic
938018295 2:127885694-127885716 CCCGGCCCCGCCGCCCGCCCCGG + Intronic
938408719 2:131046652-131046674 CCTGGCACCACTGGCCGGGCTGG - Exonic
941010373 2:160292920-160292942 CCTTGCCCCACTGGCCACCTAGG + Intronic
941812265 2:169767024-169767046 CTGAGCCCAGCTGGCCGCCCCGG - Intronic
942505496 2:176637779-176637801 CCCGGCCCTCCTGGCCGCGCTGG - Intergenic
942965881 2:181891961-181891983 CCGGGGCCCCCTGCCCGGCCGGG + Exonic
944414161 2:199467021-199467043 GCGGCCCCGGCTGGCCGCCCAGG + Intronic
946371907 2:219286115-219286137 CCGGCCCCCACCCGCCACCCAGG - Exonic
946831665 2:223734162-223734184 TTGGGCCCCACTGGCAGCCAGGG - Intergenic
947188033 2:227472336-227472358 CGCGGTCCCACGGGCCGCCCTGG - Exonic
947641450 2:231709721-231709743 CTCGGTCCCACTGCCCGCCCTGG + Intronic
947822812 2:233083754-233083776 CCAGGCCTCCCTGGCCACCCTGG - Intronic
948614848 2:239191761-239191783 CCTGGCCCTGCTGGCTGCCCTGG + Intronic
948786172 2:240354105-240354127 CCTGGCCCCACTGCACACCCTGG + Intergenic
949012166 2:241686998-241687020 CGGGGCCCCAGTTTCCGCCCCGG - Intergenic
949028630 2:241777858-241777880 TAGGGCCCCCCTGGCTGCCCTGG + Intronic
1169145332 20:3248619-3248641 CGGGCCCCCGCTGGCCGCGCAGG - Intergenic
1169483523 20:6006513-6006535 CCGGGCCCCACTGGCCGCCCGGG - Exonic
1170972221 20:21126330-21126352 CCAGGCCCCACTGGGAGCCTGGG - Intronic
1171446350 20:25207245-25207267 CCGGGCCCCCGGGGCTGCCCTGG - Exonic
1171466997 20:25336792-25336814 CCAGGCCCCGCTGTCCTCCCCGG - Intronic
1172134302 20:32676669-32676691 CCGGCCTCCAGTGGCCTCCCAGG - Intergenic
1173243475 20:41317782-41317804 CCAGGCCCCCCAGTCCGCCCAGG + Intergenic
1175928225 20:62481107-62481129 CCGGGCCCCACAGCCCTGCCAGG - Intergenic
1175930019 20:62489502-62489524 CCGGAGCCCACTGGCCACGCTGG - Intergenic
1175997322 20:62817579-62817601 CCCGGCCCCCCCGGCCCCCCAGG + Exonic
1175997332 20:62817589-62817611 CCGGCCCCCCAGGGCCGCCCGGG + Exonic
1176039102 20:63055078-63055100 CCTGGCCCCTCCGGCTGCCCCGG - Intergenic
1176286807 21:5022843-5022865 CCACGCCCCGCCGGCCGCCCCGG - Intronic
1176547773 21:8208946-8208968 CCGGGCCCCACCCCCCGACCCGG - Intergenic
1176555669 21:8253151-8253173 CCGGGCCCCACCCCCCGACCCGG - Intergenic
1176566718 21:8391985-8392007 CCGGGCCCCACCCCCCGACCCGG - Intergenic
1176574599 21:8436180-8436202 CCGGGCCCCACCCCCCGACCCGG - Intergenic
1176611212 21:8987472-8987494 CCGGGCCCCACCCCCCGACCCGG - Intergenic
1179801796 21:43814699-43814721 CCTGGTCCCACTGGGAGCCCTGG + Intergenic
1179870374 21:44240632-44240654 CCACGCCCCGCCGGCCGCCCCGG + Intronic
1180038528 21:45263727-45263749 CCAGGCCACACTGGGGGCCCAGG + Intergenic
1180078980 21:45477786-45477808 CCGGGCCCACCTGGCCGGGCAGG + Exonic
1180080840 21:45486939-45486961 CCAGGCCCCCCTGGGCCCCCTGG + Exonic
1180081991 21:45491255-45491277 CCGGGCCTCCCTGGCCCCCCCGG + Exonic
1180084988 21:45504500-45504522 CCCGGCCCCCCCGGCCCCCCAGG + Exonic
1180084995 21:45504509-45504531 CCCGGCCCCCCAGGCCCCCCAGG + Exonic
1180085211 21:45505224-45505246 CCCGGCCCCCCAGGCCCCCCAGG + Exonic
1180085262 21:45505378-45505400 CCGGGCCCCCCTGGGCCCCCTGG + Exonic
1180143662 21:45908124-45908146 TTGGGCCTCACTGGCTGCCCTGG - Intronic
1180305877 22:11124297-11124319 CTTAGCCCCACTGGCCACCCTGG - Intergenic
1180544396 22:16486480-16486502 CTTAGCCCCACTGGCCACCCTGG - Intergenic
1180557855 22:16592100-16592122 CCTGGCCACACTGCCCTCCCTGG - Exonic
1180949382 22:19714393-19714415 CCCGCCCCCCCGGGCCGCCCTGG + Intergenic
1182063764 22:27416484-27416506 CCGGCCCCCTCTGGCACCCCCGG + Intergenic
1182278598 22:29205768-29205790 CGGGGGCGCCCTGGCCGCCCGGG + Intergenic
1182353165 22:29710259-29710281 CCTGGCCCCGCTGGCAGCCCTGG + Intergenic
1182421553 22:30250989-30251011 CCGGGCACCCCCGGCTGCCCAGG + Intergenic
1183444445 22:37843933-37843955 CCAGGCCCCACCGGCGGCTCGGG - Exonic
1183508666 22:38222816-38222838 CCAGGCCCCACAGGGCACCCAGG + Intronic
1183601631 22:38843631-38843653 CCGGGCCCCCCGCGCTGCCCGGG - Exonic
1183702235 22:39457288-39457310 CCGGGCCCCCGCCGCCGCCCCGG + Intergenic
1184497165 22:44848704-44848726 CCAGTCCCCACTGGGAGCCCGGG + Intronic
1184523779 22:45009799-45009821 CCGGGCCGCGCCGGCAGCCCGGG - Intronic
1184709996 22:46244209-46244231 CCTGGCCCCACTGCCTGCCGGGG - Exonic
1184784678 22:46665930-46665952 CCTGGCTCTGCTGGCCGCCCGGG - Intronic
1185272380 22:49935318-49935340 CCGCGCCCCGCCGCCCGCCCGGG - Intergenic
1185412976 22:50695568-50695590 CCGGAGCCCACTGGCCTCTCTGG + Intergenic
1203252647 22_KI270733v1_random:125231-125253 CCGGGCCCCACCCCCCGACCCGG - Intergenic
1203260703 22_KI270733v1_random:170317-170339 CCGGGCCCCACCCCCCGACCCGG - Intergenic
950408084 3:12816939-12816961 ACTGGCCACACTGGCAGCCCTGG + Exonic
950730078 3:14948562-14948584 CCCGGCCCCACTCTTCGCCCCGG - Intronic
952064094 3:29546999-29547021 CAGGGTCCCACTGGTCACCCAGG + Intronic
952421160 3:33132412-33132434 CTGGGGCCGACTGGCAGCCCTGG - Intronic
953614396 3:44477483-44477505 CCGGGCCCCGTCCGCCGCCCGGG + Intronic
954135010 3:48578460-48578482 CCTGGCCCCTCTGGTCCCCCTGG - Exonic
954135997 3:48582485-48582507 CCAGGACCCACTGGCCGCCAAGG - Exonic
954152088 3:48662714-48662736 CCGGGCCCCTGCCGCCGCCCCGG + Exonic
955575971 3:60363750-60363772 CCTGGCCCCCCTGGCCCCCCTGG + Intronic
957656816 3:83089947-83089969 CCAGGCCCCACTTCCCGCACTGG + Intergenic
960969460 3:123129350-123129372 CTGGGCCCCACTGGCCACCATGG - Intronic
962125947 3:132617816-132617838 CCTGGCCACACTGGCCTCTCTGG + Intronic
964771238 3:160225962-160225984 CCGGGCGCGCCTGGCCGCGCGGG - Exonic
966879983 3:184344754-184344776 CCTGGGCCCACTGGAGGCCCAGG + Exonic
968452086 4:680595-680617 CCGGGCCGCCCTGGCCGCCCGGG - Intronic
968509014 4:987261-987283 CCGGGACCCCCTGGCCGCACGGG + Intronic
968550227 4:1218684-1218706 CCGCGGGCCTCTGGCCGCCCTGG + Intronic
968568101 4:1325661-1325683 CAGGGCCCCACCTGCCTCCCAGG - Intronic
968803147 4:2756124-2756146 CCGCGCCCGCCTGGCCGCGCTGG - Exonic
968893405 4:3384848-3384870 CCGGGGTCCACTGCCAGCCCTGG - Intronic
968911117 4:3477437-3477459 ACGGGCCACACTGGCCGCCTGGG + Intronic
969445265 4:7241248-7241270 CCAAGCCCCACCGGCCCCCCAGG - Intronic
970600724 4:17639257-17639279 CCAGGCCCGGCTGGCTGCCCTGG - Exonic
970615703 4:17766821-17766843 CCTGGTCCCATTGACCGCCCAGG - Intronic
971257873 4:25030696-25030718 CCGGTCCCCGCTCCCCGCCCGGG + Exonic
974047481 4:56908983-56909005 CCGGGCCCCTCCGACCGCCCCGG - Intronic
979919505 4:126479619-126479641 CGGGGCCCCAGCGGCAGCCCTGG - Intergenic
984734807 4:183099187-183099209 CCGTCCCCCTCTGGCCGCCGAGG - Intergenic
985452630 4:190069719-190069741 CCGGGCCCCTGCAGCCGCCCAGG + Intergenic
986471411 5:8080613-8080635 CCAGGCCCCACTGGAAGCTCCGG + Intergenic
989209600 5:38846069-38846091 CCGCGCCCCACGCGCCGCCGAGG + Exonic
990910228 5:60844475-60844497 CTGGGGCCCACCGGCCGCTCTGG + Intergenic
990955382 5:61333573-61333595 GCGAGCTCCACTGGCCGCCCGGG + Intronic
991298265 5:65103373-65103395 CCGCCCCCACCTGGCCGCCCTGG + Intergenic
992105288 5:73444942-73444964 CCGGACTCCACGCGCCGCCCCGG - Intronic
992957231 5:81922452-81922474 GGGGGCCCCACTGCCTGCCCAGG - Intergenic
995528238 5:113067815-113067837 TCTGGCCCCACTGTCAGCCCAGG + Intronic
997713987 5:136028847-136028869 CCGTGCGCCCCTGGCTGCCCTGG - Intergenic
998131972 5:139655878-139655900 GCGGGCCTCACTGGCCTCCCAGG + Intronic
998641935 5:144021357-144021379 ACTGACCCCACTGCCCGCCCCGG + Intergenic
999424682 5:151476890-151476912 CCAGCCCTCACTGGCTGCCCTGG + Intronic
999462956 5:151772324-151772346 CCTGGCCCCAGAGACCGCCCTGG - Intronic
1002065013 5:176647545-176647567 CAGCGCCCCGCGGGCCGCCCTGG - Exonic
1002140223 5:177133508-177133530 CCGGGGCCTACGGGCCGGCCCGG - Intronic
1002201490 5:177531300-177531322 CCGGGCCCGCTTGGCGGCCCTGG + Intronic
1002299160 5:178247782-178247804 CCTGGCCCCCCTGGCCCCCCAGG - Exonic
1002299165 5:178247791-178247813 CCAGGGCCCCCTGGCCCCCCTGG - Exonic
1002329416 5:178431177-178431199 CCTGGGCCCACTGGCCTTCCTGG - Intronic
1002439477 5:179256979-179257001 CAGGCCCACACTGGCGGCCCCGG + Intronic
1002600617 5:180352530-180352552 CCCGGCCCCGCTCCCCGCCCCGG + Intronic
1003639911 6:7868005-7868027 CCTGGCCCCAGTGCCCTCCCAGG - Intronic
1005813004 6:29530603-29530625 CTGGGCACCATTGGCCACCCAGG - Intergenic
1006298421 6:33180313-33180335 CAGGGCCCCCCTGGCCGAGCAGG - Exonic
1009939252 6:70270321-70270343 CCTGGCCCCCCTGGCCCCCCAGG - Exonic
1010229197 6:73520456-73520478 CCGGGCCAGCCTTGCCGCCCAGG + Exonic
1010369161 6:75087669-75087691 CCTGGCCCCCCTGGCCGTCCTGG - Exonic
1013161564 6:107550020-107550042 CCTGTCCCCACTGGCCTTCCAGG - Intronic
1013196360 6:107848311-107848333 TCCAGCCCCACTGGCCGGCCCGG + Intergenic
1016429094 6:143964240-143964262 CCAGCCCTCACTGGCGGCCCTGG + Intronic
1018848940 6:167574031-167574053 CCGTTCCCCCCTGGCCTCCCTGG + Intergenic
1019442773 7:1055823-1055845 CCTGGCCTCACGGGGCGCCCAGG - Intronic
1019457454 7:1137993-1138015 CCGGGACGCACCGGCCGCACCGG + Exonic
1019482972 7:1274811-1274833 CCGGGCCACTCTGGACGGCCTGG + Intergenic
1019537574 7:1537263-1537285 CCCGGGCCCACTGCCCGCCGTGG - Intronic
1019614710 7:1953991-1954013 TCGGGGCTCACAGGCCGCCCTGG - Intronic
1019701200 7:2475716-2475738 CCGGGCCCCAGCGGCCGTACTGG + Exonic
1020066206 7:5190319-5190341 CCGGGCCCCGCTCGCCGCCTCGG - Exonic
1020204689 7:6105311-6105333 CCGGGCCCCCCTGGTTGCCATGG + Intronic
1020369644 7:7417881-7417903 CCTGGCCCTCCTGGCCCCCCTGG - Exonic
1025224996 7:57150481-57150503 CCTGCCGCGACTGGCCGCCCTGG - Intergenic
1028755365 7:94427624-94427646 CAGGGCCCCCCTGGTCCCCCTGG + Exonic
1032334391 7:131011578-131011600 CTGGGCCCCACTGGCCTTCCAGG + Intergenic
1033253038 7:139777392-139777414 CCCGGCCCCTCTCCCCGCCCTGG + Intronic
1033299898 7:140176584-140176606 GCGCGCCCCACTGCCCGGCCGGG + Intronic
1034490999 7:151392950-151392972 CTGAGCCCCACTGGCCACCTGGG + Intronic
1034619460 7:152445905-152445927 CCTGGCCACACTGCCCTCCCTGG + Intergenic
1034952213 7:155306440-155306462 CCCGGCCCCACTGGGCCACCTGG + Intronic
1035158764 7:156935581-156935603 ACTGGCCCCACTGGCCCCCTGGG + Intergenic
1035336854 7:158134979-158135001 CTGGGCCGCACTGCCCTCCCAGG + Intronic
1035362453 7:158322521-158322543 CCTGGCCCCAGTGGGCGGCCAGG + Intronic
1036785127 8:11680727-11680749 CCGGGCTCTCCTCGCCGCCCAGG - Intronic
1039480571 8:37870318-37870340 CCTGGCACCACCGGCTGCCCAGG + Intronic
1042800144 8:72709705-72709727 CCAGGCCCCACCTGCAGCCCTGG + Intronic
1046915309 8:119672877-119672899 CCGGGCCCGTCTCGCCGCCCAGG + Intronic
1048302952 8:133264997-133265019 TCAGGCCCCACTGGCCCCACAGG + Intronic
1048851515 8:138649735-138649757 CCTGGCCCCCCAGGCCTCCCTGG - Exonic
1049177946 8:141205819-141205841 CCGCACCCCGGTGGCCGCCCGGG - Intergenic
1049190543 8:141285041-141285063 CCGAGCCCCACTGCCAGCTCCGG - Intronic
1049208707 8:141375481-141375503 TCAGCCCCCACTGGCAGCCCTGG + Intergenic
1049218580 8:141418664-141418686 CGGGGACCCACTGGCAGCCGTGG - Intronic
1056914007 9:90729571-90729593 CCGGCCACCCCTGCCCGCCCGGG + Intergenic
1056922419 9:90802159-90802181 CCGGGCACCCCAGGGCGCCCAGG + Intronic
1059433938 9:114265428-114265450 CCGGGTCCCTCAGGCCCCCCAGG + Exonic
1060200989 9:121651710-121651732 ACGGGCCCCATCGGCCGCTCCGG - Intronic
1060214426 9:121730125-121730147 CCAACCCCCACTGGCCGCCAAGG + Intronic
1060418809 9:123452767-123452789 CAGGGCCCCACTTTCTGCCCCGG - Intronic
1060740294 9:126093391-126093413 CTGGGCCCCACTGGCTGCAGAGG + Intergenic
1060926171 9:127456918-127456940 CCTGGCCCCTCTGCCAGCCCTGG + Intronic
1061000482 9:127899577-127899599 CCGCGCTCCTCAGGCCGCCCAGG + Exonic
1061196720 9:129110748-129110770 CCGGGCACCGTTGCCCGCCCGGG - Exonic
1061377701 9:130235913-130235935 CCGTGGCCGACTGGCCGCCTGGG - Exonic
1062105004 9:134750539-134750561 CAGGGCCCCCCTGGACGCCCAGG + Exonic
1062116577 9:134812611-134812633 CCGGGTCCCCCTGGCCCCCGAGG + Exonic
1062135172 9:134922989-134923011 CAGGACCCCTCTGGCTGCCCTGG - Intergenic
1062147247 9:134996508-134996530 CCTGGCCCCACTGACTGCCTGGG - Intergenic
1062365244 9:136205200-136205222 CGGGGCCCCTCTCGTCGCCCCGG + Intergenic
1062426678 9:136509215-136509237 CGGGTTCCCACTGGCCTCCCTGG - Intronic
1062449262 9:136608679-136608701 CTGGGCCCCACCCGGCGCCCCGG - Intergenic
1062453358 9:136624723-136624745 CCGGGCCCCTCTGGCCACACAGG + Intergenic
1062577045 9:137213723-137213745 CTGGGCACCACTCTCCGCCCGGG + Intronic
1062656539 9:137606701-137606723 CCTGGCCCCACTGGGCCTCCTGG + Intronic
1203787096 EBV:134136-134158 CCGGTCCCGACCCGCCGCCCCGG - Intergenic
1203469050 Un_GL000220v1:108382-108404 CCGGGCCCCACCCCCCGACCCGG - Intergenic
1203476871 Un_GL000220v1:152354-152376 CCGGGCCCCACCCCCCGACCCGG - Intergenic
1185457554 X:318460-318482 CCGGGCCCCACTTGACGTCAGGG + Exonic
1185465348 X:351142-351164 CCGGGCCCCGCAGGACGCACAGG + Intronic
1185782455 X:2861439-2861461 CAGGGCCCCACCCGCCCCCCAGG + Intronic
1192584004 X:72306251-72306273 CCCGGCCCCGCTGGCCGGCAGGG + Intronic
1195751546 X:108165011-108165033 CCAGGCCCCGCTGGACCCCCAGG - Exonic
1200164592 X:154027327-154027349 TCAGGCCCCACTGGCAGCTCTGG + Intronic
1201185274 Y:11395660-11395682 CTTAGCCCCACTGGCCACCCTGG - Intergenic