ID: 1169486606

View in Genome Browser
Species Human (GRCh38)
Location 20:6039894-6039916
Sequence GTGGGGTTGGTTCCTCTTGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 450
Summary {0: 1, 1: 1, 2: 7, 3: 64, 4: 377}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169486606_1169486615 15 Left 1169486606 20:6039894-6039916 CCTCCAAGAGGAACCAACCCCAC 0: 1
1: 1
2: 7
3: 64
4: 377
Right 1169486615 20:6039932-6039954 GGATTTCCGGCCTGAACTGTAGG 0: 1
1: 0
2: 0
3: 6
4: 73
1169486606_1169486611 -6 Left 1169486606 20:6039894-6039916 CCTCCAAGAGGAACCAACCCCAC 0: 1
1: 1
2: 7
3: 64
4: 377
Right 1169486611 20:6039911-6039933 CCCCACTGATGCTTTGATTTGGG 0: 1
1: 1
2: 9
3: 46
4: 280
1169486606_1169486614 2 Left 1169486606 20:6039894-6039916 CCTCCAAGAGGAACCAACCCCAC 0: 1
1: 1
2: 7
3: 64
4: 377
Right 1169486614 20:6039919-6039941 ATGCTTTGATTTGGGATTTCCGG 0: 1
1: 2
2: 3
3: 58
4: 464
1169486606_1169486609 -7 Left 1169486606 20:6039894-6039916 CCTCCAAGAGGAACCAACCCCAC 0: 1
1: 1
2: 7
3: 64
4: 377
Right 1169486609 20:6039910-6039932 ACCCCACTGATGCTTTGATTTGG 0: 1
1: 0
2: 1
3: 10
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169486606 Original CRISPR GTGGGGTTGGTTCCTCTTGG AGG (reversed) Exonic