ID: 1169486833

View in Genome Browser
Species Human (GRCh38)
Location 20:6041451-6041473
Sequence GACCAGCGCCGACGTGTCCG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 31
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 27}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169486827_1169486833 10 Left 1169486827 20:6041418-6041440 CCCATGCACTACCGAGTTGGGGG 0: 1
1: 0
2: 1
3: 6
4: 42
Right 1169486833 20:6041451-6041473 GACCAGCGCCGACGTGTCCGTGG 0: 1
1: 0
2: 0
3: 3
4: 27
1169486829_1169486833 9 Left 1169486829 20:6041419-6041441 CCATGCACTACCGAGTTGGGGGC 0: 1
1: 0
2: 0
3: 2
4: 49
Right 1169486833 20:6041451-6041473 GACCAGCGCCGACGTGTCCGTGG 0: 1
1: 0
2: 0
3: 3
4: 27
1169486830_1169486833 -1 Left 1169486830 20:6041429-6041451 CCGAGTTGGGGGCACACCAGTGG 0: 1
1: 0
2: 0
3: 11
4: 100
Right 1169486833 20:6041451-6041473 GACCAGCGCCGACGTGTCCGTGG 0: 1
1: 0
2: 0
3: 3
4: 27

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169486833 Original CRISPR GACCAGCGCCGACGTGTCCG TGG Exonic
901511537 1:9720327-9720349 GCCCAGCCCCGACGTGGCCAGGG - Intronic
904293107 1:29500247-29500269 GAACAGCACAGTCGTGTCCGAGG + Intergenic
905137102 1:35808277-35808299 GCCCAGCGCCCGCGTCTCCGCGG + Exonic
923490311 1:234478531-234478553 CACCAGCGCCGCCGCGTCCTCGG + Exonic
1064971178 10:21068613-21068635 GACCAGAGCCCATGGGTCCGGGG - Intronic
1071527692 10:86367435-86367457 AACCAGCGCAGCCGTGACCGCGG + Intergenic
1076900831 10:133336562-133336584 GACCACCGCCCTCGGGTCCGCGG + Intronic
1088511525 11:110580409-110580431 GAGCAGCGCCGATGTGTCCTTGG + Exonic
1141594510 16:85089037-85089059 CAGCAGTGCCGAGGTGTCCGCGG + Exonic
1147611249 17:41803073-41803095 GACCAGCTGAGACCTGTCCGGGG - Intronic
1155030411 18:21979022-21979044 GAGCAGGGCCGCTGTGTCCGTGG + Intergenic
1162524047 19:11197362-11197384 GACCAGCGAGGTCGTGTCCCAGG + Intronic
1165489316 19:36114217-36114239 GATTATCGCCGACGTGTCCCAGG - Exonic
1167268232 19:48493819-48493841 GAGCAGCGCCGACGCGGACGCGG - Exonic
927935022 2:27071550-27071572 GGCCAGCCCCGCCGTGGCCGTGG - Intronic
948658506 2:239491852-239491874 GACCACCGCCCATGTGTCCGTGG + Intergenic
1169486833 20:6041451-6041473 GACCAGCGCCGACGTGTCCGTGG + Exonic
1170893179 20:20392934-20392956 CACCAGTGCCCACGTGTCAGTGG + Exonic
1172702693 20:36862903-36862925 GAGCAGCGACGCCGAGTCCGCGG - Exonic
1179891892 21:44339372-44339394 GAGCAGAGCCAACGTGTCAGCGG - Exonic
949294562 3:2506314-2506336 TACCAGAGCCGAAGAGTCCGTGG + Intronic
1006052668 6:31356288-31356310 GATCTGAGCCGCCGTGTCCGCGG + Exonic
1027183260 7:75954022-75954044 CACCAGCTCCACCGTGTCCGAGG + Exonic
1031986632 7:128167956-128167978 GACCAGCGCGTACCTGTGCGTGG - Intergenic
1034899443 7:154898469-154898491 GACCAGAGCCGCCGTGTCTGCGG + Intergenic
1036032710 8:4991675-4991697 GCCCAGCGCCGACGCCCCCGGGG + Intronic
1038883707 8:31640428-31640450 GCCCAGCGCCGGCGAGCCCGGGG + Intronic
1061293616 9:129665893-129665915 GCCCAGCGCCGGCTTGTCCAGGG - Exonic
1061864493 9:133485385-133485407 CACCAGGGCCGAGGTCTCCGAGG + Intergenic
1185551048 X:982655-982677 GACCAGCGTGGCCGTGTCTGCGG + Intergenic
1189324976 X:40106479-40106501 GCCCAGCGCCGACGACTCGGCGG + Intronic