ID: 1169488084

View in Genome Browser
Species Human (GRCh38)
Location 20:6050341-6050363
Sequence TCCCTTGGAAGTCTATGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 2, 3: 6, 4: 110}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169488084_1169488089 26 Left 1169488084 20:6050341-6050363 CCTGCCCATAGACTTCCAAGGGA 0: 1
1: 0
2: 2
3: 6
4: 110
Right 1169488089 20:6050390-6050412 CCCTAGACCCACTCAAATTCTGG 0: 1
1: 0
2: 1
3: 8
4: 80
1169488084_1169488091 30 Left 1169488084 20:6050341-6050363 CCTGCCCATAGACTTCCAAGGGA 0: 1
1: 0
2: 2
3: 6
4: 110
Right 1169488091 20:6050394-6050416 AGACCCACTCAAATTCTGGAAGG 0: 1
1: 3
2: 9
3: 68
4: 587

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169488084 Original CRISPR TCCCTTGGAAGTCTATGGGC AGG (reversed) Intronic
908790602 1:67777254-67777276 TCCTTTGTAAGACCATGGGCAGG - Intronic
909081423 1:71117035-71117057 TCCCTTCAAACTCTCTGGGCTGG - Intergenic
913535090 1:119764353-119764375 TCCCATGGGACTCTGTGGGCAGG - Exonic
1064008977 10:11720157-11720179 TCATTTGGCAGGCTATGGGCTGG - Intergenic
1068686318 10:59873461-59873483 TCCCTTGGAAACCTCTGGCCGGG - Intronic
1070965955 10:80530508-80530530 TCCCTGGGAGGTCTCTGGGCTGG + Exonic
1073856945 10:107687266-107687288 TTCCTTGGAAGTCTAATTGCTGG - Intergenic
1078776966 11:14402752-14402774 TCCCTTGAAATATTATGGGCTGG + Intergenic
1078894517 11:15586133-15586155 CCCCTTTGACTTCTATGGGCGGG - Intergenic
1081934602 11:46896140-46896162 TCCCTTTGAACCCTATGGGTGGG + Intronic
1085242606 11:75071261-75071283 TGACGTGGAAGTCTAGGGGCAGG + Intergenic
1088909987 11:114183520-114183542 TCCCTTGGAAGCCTGTGGCATGG + Intronic
1089664823 11:120011700-120011722 TCCAGTGGAAATCTCTGGGCTGG - Intergenic
1089849741 11:121485949-121485971 TCCCTGGGAAGTTTATGGTCTGG + Intronic
1090782501 11:130020464-130020486 TCCCTCAGAAGTCTCTGGGAAGG + Intergenic
1093417538 12:18937057-18937079 TCCATTGGAAGCCCCTGGGCAGG - Intergenic
1096915127 12:55023648-55023670 TCTCTTGGAAGTTAATGGACCGG + Intronic
1101840530 12:108324554-108324576 CCCCTTGGAAGTCTTTGGGTCGG - Intronic
1103877666 12:124141159-124141181 TCCTTTGGATGTCTGTGGCCAGG + Intronic
1114142270 14:19926951-19926973 TCACTTGGAAATCAATGGTCAGG - Intergenic
1118609796 14:67531407-67531429 CCCCTTGGCAGTCTGTGGGAGGG - Intronic
1118822745 14:69355692-69355714 TCCCCCGAAAGCCTATGGGCAGG + Exonic
1121589551 14:95092851-95092873 ACACTTGGAAGTCTACGAGCTGG + Intronic
1122208626 14:100160704-100160726 TCCCATGGAAGTCCATGGCCCGG + Intergenic
1127301289 15:57656240-57656262 TCCCCCTGAAGTCTATGGGATGG + Intronic
1135278826 16:21136573-21136595 TCCCTTGGCAGCTGATGGGCAGG - Intronic
1137337034 16:47559782-47559804 TCCCCTGCTAGACTATGGGCTGG - Intronic
1140955550 16:79861622-79861644 TCCCTTGGAGGTCTGTTGACAGG + Intergenic
1142374563 16:89700491-89700513 TCCCTGTGAAGTCTCAGGGCTGG - Intronic
1145961033 17:28886662-28886684 TCCCTAGGCAGTCTGTGTGCAGG + Intronic
1145962476 17:28895557-28895579 TACCTTGAAAATCTATTGGCCGG - Intronic
1148464227 17:47855469-47855491 TCCCTTGGAGGTCTTTTGACTGG - Intronic
1148970729 17:51478937-51478959 TCCCTTTGAGGTCTAATGGCAGG - Intergenic
1149530000 17:57387607-57387629 ACCATTGGAAGTTGATGGGCTGG + Intronic
1149649816 17:58269673-58269695 TCTCTTGGAAGCCTGGGGGCCGG - Intergenic
1150543047 17:66123279-66123301 TCCCTTTGAAGTCTAAGTGGAGG - Intronic
1153633182 18:7091482-7091504 GCCTTTGGAAGTGTTTGGGCTGG - Intronic
1155646368 18:28083047-28083069 CCCCTAGGAAGTCCATAGGCAGG - Intronic
1157309358 18:46540552-46540574 ACCCCTGGAAGTTTCTGGGCAGG + Intronic
1159309646 18:66690307-66690329 TTCCTTGGCAGTCTATCTGCAGG - Intergenic
1161212428 19:3074339-3074361 CCCCTTGGGTGTCTATGGGGAGG - Intergenic
1161460612 19:4394762-4394784 ACCCTTGGAAGTCTAGAGCCTGG + Intronic
1161983104 19:7640742-7640764 TCCCCTGGAAGTCTTTGATCAGG - Exonic
1162926057 19:13930954-13930976 TCCCCTGGAAGTGGATGGGGAGG + Intergenic
1163791082 19:19306426-19306448 TCCCTTGGAGGTCTGTGGCCAGG + Intronic
1165483541 19:36081201-36081223 TCCCTTGGAAGTTTATTTGAGGG + Intronic
1165900414 19:39166990-39167012 TCCCTTGGGGGTTTATGGGTGGG + Intronic
925226811 2:2190468-2190490 TCCCCAGGAAGTCTAAAGGCTGG - Intronic
926419444 2:12682323-12682345 TCCCTGAGAAGTATATTGGCTGG - Intergenic
934037035 2:88096869-88096891 TCCCTAGGAAGCTCATGGGCAGG - Intronic
937861798 2:126717155-126717177 TCCCTTGAAGGTCTGTGGCCAGG + Intergenic
938319635 2:130354560-130354582 TCCCTTGGATGTTCATGGGGGGG - Intergenic
946394464 2:219436173-219436195 GCACCTGGAAATCTATGGGCGGG - Intronic
946485949 2:220100893-220100915 TCCCTTGCTAGGCTATAGGCTGG + Intergenic
947102419 2:226635750-226635772 TCCCTTGAAATTCTATTTGCAGG + Intergenic
948279392 2:236734913-236734935 TCCCATGGATGTCTGTGGGTTGG + Intergenic
1169488084 20:6050341-6050363 TCCCTTGGAAGTCTATGGGCAGG - Intronic
1175527800 20:59647499-59647521 GCCCTTGGAGGTCCATTGGCAGG + Intronic
1180817246 22:18798658-18798680 GTCCTTGGAGGTCTAAGGGCGGG - Intergenic
1181203436 22:21232979-21233001 GTCCTTGGAGGTCTAAGGGCGGG - Intergenic
1182257800 22:29050704-29050726 TCCCTTGGCAGTCCGAGGGCAGG - Exonic
1182323133 22:29491312-29491334 TCCCTGGGAAGGCTGGGGGCAGG + Exonic
1183036135 22:35142288-35142310 CCCCTTGGTACTCTCTGGGCTGG + Intergenic
1185223640 22:49641217-49641239 TCCCTGGGGTGTCTGTGGGCAGG - Intronic
1203223484 22_KI270731v1_random:62435-62457 GTCCTTGGAGGTCTAAGGGCAGG + Intergenic
1203267345 22_KI270734v1_random:24385-24407 GTCCTTGGAGGTCTAAGGGCGGG - Intergenic
957585182 3:82123743-82123765 TCCCTTGTAAGTCTTTGATCAGG - Intergenic
958490517 3:94766460-94766482 TCCCTTGCAAATCGAAGGGCCGG + Intergenic
958962788 3:100525921-100525943 GCCCTTGGAGGTCCCTGGGCTGG + Intronic
958996859 3:100915276-100915298 TCCCTTGGAGGTCTATGAATTGG - Intronic
959472703 3:106772291-106772313 TCTCTTGGAGGTCTAGGGGTAGG - Intergenic
959837907 3:110942621-110942643 TCCCTTGGAAGATGATGGGTGGG + Intergenic
961548481 3:127652634-127652656 ACACGTGGAAGTCTAAGGGCTGG - Intronic
962263655 3:133930551-133930573 TCCCTTGAAGGTCTGTGTGCAGG + Intergenic
962821661 3:139054581-139054603 TCCCATGGCAGTATATGTGCTGG + Intronic
962939542 3:140113307-140113329 ACCCTTTGAAGCCTAGGGGCTGG + Intronic
964649590 3:158995862-158995884 GACCTTGGAAGACTGTGGGCGGG + Intronic
972342685 4:38166088-38166110 TCCCCAGGAAGCCCATGGGCAGG + Intergenic
974906262 4:68061811-68061833 TCCCTTGCAAGTCTTTAGACAGG - Intronic
976921918 4:90452649-90452671 TCATTGGGAAGTCTAAGGGCTGG + Intronic
986637503 5:9837455-9837477 TGCCTTGGAAGTAAATAGGCGGG + Intergenic
988471497 5:31543806-31543828 TTCAGTGGAAGTCTGTGGGCTGG - Intronic
990264802 5:54063221-54063243 TGCCTTGACAGACTATGGGCTGG + Intronic
991365868 5:65867383-65867405 TCCCATGGAATTCTGGGGGCTGG - Intronic
991607081 5:68413487-68413509 TCCCTTGGAAGTGTATGGGTGGG - Intergenic
991926960 5:71715083-71715105 TCCTTTGGAAGGCTATGGCTTGG + Intergenic
992638248 5:78746364-78746386 TCCCTTGGAAGTCTATGGTGGGG + Intronic
996193276 5:120571673-120571695 TACCTTGGAAGAGTATGAGCTGG + Intronic
998516891 5:142764045-142764067 ACACTTGGAAGTGTATTGGCTGG - Intergenic
1000044103 5:157507410-157507432 TTCCTTGGAAGGAAATGGGCAGG + Intronic
1001552141 5:172610859-172610881 CCCCTTGGAACTCCAGGGGCTGG - Intergenic
1007947467 6:45839218-45839240 TCCCTTGGCAGTCTAACAGCTGG + Intergenic
1012157373 6:95836502-95836524 TCCTTTTGAAGCCTATTGGCTGG - Intergenic
1012848855 6:104423709-104423731 ACCCTAAGAAGTCTATGGCCAGG - Intergenic
1013116179 6:107105467-107105489 CCTTTTGGAAATCTATGGGCTGG - Intronic
1014767978 6:125429002-125429024 TCACTTGGATAGCTATGGGCAGG - Intergenic
1022734542 7:33063341-33063363 TCCCTTGGAAGACACTAGGCAGG - Intergenic
1022741891 7:33129711-33129733 TCCCTTGGAAGACACTAGGCAGG - Exonic
1023009128 7:35909584-35909606 TCACTTTGAAGTCTAAGGGAAGG + Intergenic
1023017178 7:35980131-35980153 TCACTTTGAAGTCTAAGGGAAGG + Intergenic
1023795586 7:43789442-43789464 TCCCTTGGAATCTTATGGGGAGG - Intronic
1030009351 7:105150767-105150789 TTCCTTTGACCTCTATGGGCTGG - Intronic
1031975219 7:128089406-128089428 TTTCTTGGGAGTCTATGGACAGG + Intronic
1032459917 7:132102788-132102810 TCACTTGGAAGTCAGTGGGAAGG + Intergenic
1032740328 7:134732260-134732282 GCCCTTGAAAGTATTTGGGCAGG - Intergenic
1034932229 7:155171736-155171758 TCCCTTACAAGCCTAAGGGCTGG - Intergenic
1037449476 8:19002247-19002269 TTCCTTGGAGGTCTTTAGGCTGG - Intronic
1041042871 8:53864533-53864555 CCCCTTGGAATCCTATGGGCTGG + Intronic
1041487515 8:58395359-58395381 TACACTGGAAGTCTGTGGGCTGG + Intergenic
1044715128 8:95093108-95093130 TCCCTTGGGAGTGTAAGGGGTGG + Intronic
1046871015 8:119206062-119206084 TCCAAAGGAAGTCTATGAGCAGG + Intronic
1048848589 8:138622814-138622836 GCCCTTGGTATTCTATGGGGTGG + Intronic
1049694897 8:143978301-143978323 TCCCGTGGAGGTCTGCGGGCGGG + Intronic
1049987360 9:964111-964133 TCTGTTGGAAGTCAATGGACTGG - Intronic
1057253256 9:93521242-93521264 TCCCTTGGAAGAAAATAGGCTGG + Intronic
1061047467 9:128174358-128174380 TTCCTTGGAAGTCACTGTGCAGG + Intronic
1062723660 9:138058891-138058913 TCCCTTTGTTGTCTGTGGGCTGG + Intronic
1187027529 X:15451281-15451303 CCCCTTGGAAGTCCACAGGCAGG - Intronic
1190311454 X:49119763-49119785 CCCCGTGGAGGCCTATGGGCTGG - Exonic