ID: 1169488431

View in Genome Browser
Species Human (GRCh38)
Location 20:6052493-6052515
Sequence CGGCCACCTGGAGCAGCTGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 427
Summary {0: 1, 1: 0, 2: 6, 3: 44, 4: 376}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169488431_1169488435 -4 Left 1169488431 20:6052493-6052515 CCTGCAGCTGCTCCAGGTGGCCG 0: 1
1: 0
2: 6
3: 44
4: 376
Right 1169488435 20:6052512-6052534 GCCGAGCTCGGAAGTGCTCAGGG 0: 1
1: 0
2: 0
3: 6
4: 100
1169488431_1169488440 25 Left 1169488431 20:6052493-6052515 CCTGCAGCTGCTCCAGGTGGCCG 0: 1
1: 0
2: 6
3: 44
4: 376
Right 1169488440 20:6052541-6052563 GCAGGTTGTGGCTGGCGTCGAGG 0: 1
1: 0
2: 0
3: 4
4: 140
1169488431_1169488439 17 Left 1169488431 20:6052493-6052515 CCTGCAGCTGCTCCAGGTGGCCG 0: 1
1: 0
2: 6
3: 44
4: 376
Right 1169488439 20:6052533-6052555 GGCGCGCAGCAGGTTGTGGCTGG 0: 1
1: 0
2: 0
3: 6
4: 257
1169488431_1169488438 13 Left 1169488431 20:6052493-6052515 CCTGCAGCTGCTCCAGGTGGCCG 0: 1
1: 0
2: 6
3: 44
4: 376
Right 1169488438 20:6052529-6052551 TCAGGGCGCGCAGCAGGTTGTGG 0: 1
1: 0
2: 3
3: 8
4: 148
1169488431_1169488437 7 Left 1169488431 20:6052493-6052515 CCTGCAGCTGCTCCAGGTGGCCG 0: 1
1: 0
2: 6
3: 44
4: 376
Right 1169488437 20:6052523-6052545 AAGTGCTCAGGGCGCGCAGCAGG 0: 1
1: 0
2: 0
3: 9
4: 121
1169488431_1169488434 -5 Left 1169488431 20:6052493-6052515 CCTGCAGCTGCTCCAGGTGGCCG 0: 1
1: 0
2: 6
3: 44
4: 376
Right 1169488434 20:6052511-6052533 GGCCGAGCTCGGAAGTGCTCAGG 0: 1
1: 0
2: 0
3: 1
4: 70

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169488431 Original CRISPR CGGCCACCTGGAGCAGCTGC AGG (reversed) Exonic
900165856 1:1244049-1244071 CCGCCCCCTGGGGCAGCAGCGGG + Exonic
900186755 1:1336478-1336500 GGTCCACCCGGAGCAGCCGCCGG - Exonic
900395726 1:2452500-2452522 CGGCCACCGTGAGCAGCAGGAGG + Intronic
900954024 1:5875786-5875808 CGGCTTCTTGGAGTAGCTGCAGG - Intronic
901706939 1:11081117-11081139 CGGGCAGCCGGTGCAGCTGCAGG - Exonic
902609343 1:17588149-17588171 CGGGCTCCTGGAGCAGCTGGGGG + Intronic
902757316 1:18557551-18557573 TGGCATCCTGGAGCAGGTGCGGG + Intergenic
903019969 1:20386975-20386997 GGGCCACCTGGAGGAGATGGGGG + Intergenic
903870029 1:26427270-26427292 CGCAGACCTGGAGCTGCTGCTGG - Exonic
904188920 1:28728259-28728281 AGGCCACCTGGCCCAGCTGCAGG + Intergenic
904380724 1:30109003-30109025 CAGCCACCTGGACCCGCTGTGGG + Intergenic
905675870 1:39824694-39824716 AGGCCACCTGGAAAAGCTGGAGG + Intergenic
906127238 1:43434425-43434447 TCGCCACCTGCAGCAGCTCCTGG + Exonic
907388779 1:54142827-54142849 CAGCCCCCTGGAGCACCTGCTGG + Intronic
909931339 1:81503040-81503062 CGCCGCACTGGAGCAGCTGCGGG + Intronic
910512400 1:88021787-88021809 GGGCCACCTGAAAAAGCTGCAGG - Intergenic
910746478 1:90580326-90580348 CTGGAACCTGCAGCAGCTGCAGG - Intergenic
912691223 1:111805877-111805899 AGGTATCCTGGAGCAGCTGCTGG + Intronic
912937982 1:114020528-114020550 CTTGCACCTGGAACAGCTGCAGG + Intergenic
913479896 1:119277998-119278020 TGAGCACCTGGAGCAGGTGCAGG - Intergenic
915034507 1:152910787-152910809 GGGGCAACTGGAGCAGCTGGAGG + Exonic
915648969 1:157293861-157293883 CCCCCACCAGGAGCAGATGCTGG - Intergenic
915679066 1:157562554-157562576 CAGCCAGCTGTAGCAGCAGCAGG + Intergenic
915934821 1:160084288-160084310 CGGCGACCTGGAGCACCTGGAGG + Exonic
916053075 1:161049438-161049460 GGGCTACCTGGAGGAGCTCCTGG - Exonic
916683603 1:167125926-167125948 GGGCTTCCTGAAGCAGCTGCGGG + Exonic
917314836 1:173713817-173713839 CGGCCTCCTGGAGCATTTGGGGG - Intergenic
918147240 1:181767531-181767553 TTGCCACCTGGAGCTGCTGCTGG + Intronic
919075541 1:192808794-192808816 CGGCCAGCTGGGGCAGGTGTGGG - Intergenic
919454257 1:197803099-197803121 CGGCCACCTGGCCGTGCTGCAGG + Intergenic
919878755 1:201888913-201888935 CGGCCAGCTGGAGCTGCGGCGGG - Exonic
920032606 1:203046262-203046284 CCGACACCTGCAGGAGCTGCTGG + Intronic
920504600 1:206507338-206507360 TCTTCACCTGGAGCAGCTGCAGG - Intergenic
920824942 1:209416299-209416321 CGGCATGCTGGGGCAGCTGCAGG + Intergenic
921379752 1:214512343-214512365 GGGCCACATGGAGAAGCAGCAGG - Intronic
921671162 1:217925289-217925311 CCGGCACCTGGCCCAGCTGCGGG + Intergenic
922158894 1:223063389-223063411 CTGCCACCTTGAGCACTTGCTGG + Intergenic
922700834 1:227759574-227759596 GCGTCACCTAGAGCAGCTGCTGG + Intronic
922810857 1:228414820-228414842 CGGCCACCTTGGTCAGCAGCCGG + Exonic
923281307 1:232445584-232445606 GGGCCTGCTGGAGCAGCTGTTGG + Exonic
923478203 1:234357063-234357085 CGTGGACCTGGACCAGCTGCTGG - Intergenic
924556596 1:245124147-245124169 TGGCCACATGGAGGAGCTGGTGG - Intronic
1063452940 10:6163653-6163675 CGGGCCCCGGGAGCAGCTGCGGG + Intronic
1064016003 10:11772928-11772950 CTGCCACCTGTGGAAGCTGCAGG - Intergenic
1065534271 10:26701839-26701861 CGTGCACCTGGAAAAGCTGCAGG + Intronic
1065762103 10:28991920-28991942 TGGCCACCAGGAGGAGCTGTTGG - Intergenic
1068938277 10:62657330-62657352 AGCCCATCTGGAGCAGCCGCTGG + Intronic
1069409529 10:68139089-68139111 CTCCAACATGGAGCAGCTGCTGG + Intronic
1070597594 10:77843544-77843566 GAGCCGCCTGGAGCAGCTGGGGG - Exonic
1070657832 10:78283368-78283390 CTCCCACCTGCAGCAGCTCCAGG - Intergenic
1071885945 10:89951057-89951079 AGGGCACCTGGTCCAGCTGCAGG - Intergenic
1073321970 10:102621039-102621061 AGCCCACTTGGAACAGCTGCTGG - Intronic
1073331201 10:102670923-102670945 CAGCCACCAGGAGCAGGGGCAGG - Intergenic
1074916539 10:117961490-117961512 CAGCTACCTGGGGCAGTTGCTGG + Intergenic
1075557262 10:123442634-123442656 CGTCCACCTGAGACAGCTGCAGG - Intergenic
1076781836 10:132728849-132728871 CGGCCACCGGGCTCAGCAGCTGG - Intronic
1076809418 10:132878901-132878923 AGCCCACCAGGAGCAGCTGTCGG - Intronic
1076850840 10:133091943-133091965 CGGCCTCGGGGAGCAGCTGCAGG - Intronic
1077033163 11:479381-479403 GGGCCTCCAGGAGCATCTGCTGG + Intronic
1077057508 11:602036-602058 AGGCCCCCAGGAGCAGCTGTGGG + Intronic
1077137863 11:1010297-1010319 CGGCCACCTGGAGAAGCTGTGGG - Intronic
1077138151 11:1011800-1011822 CGGGTCCCTGGGGCAGCTGCAGG + Exonic
1077143768 11:1035952-1035974 TGGTCACCTGCAGCAGCCGCAGG + Intronic
1077216759 11:1398267-1398289 CGGCACCCTGAATCAGCTGCAGG + Intronic
1077321023 11:1942046-1942068 GGGCCACCAGGAGCAGGTGCTGG + Intergenic
1077383951 11:2260298-2260320 CCCCCACCTGGAGCCGCTACGGG + Intergenic
1078351748 11:10600751-10600773 AGGCCCACTGAAGCAGCTGCTGG + Intronic
1079329852 11:19524257-19524279 CTGCCACTTGGAGTATCTGCTGG + Intronic
1081329736 11:41788542-41788564 CGCCCACCTGGAGCCCCAGCTGG + Intergenic
1081874292 11:46398009-46398031 CAGCCACCGGTAGCAGCTGGGGG + Intronic
1081964792 11:47162886-47162908 CTGCATCCTGGAGCAGCTTCGGG - Intronic
1082118978 11:48357650-48357672 CCGGCACCTGGAAAAGCTGCAGG - Intergenic
1082278763 11:50247480-50247502 CTGCCACCGGAAGCAGATGCTGG - Intergenic
1083651815 11:64208557-64208579 TGGCCTCCTGGAGCAGCAGCGGG + Intronic
1083741415 11:64713447-64713469 CGTCCACCAGCAGCAGCTCCAGG + Exonic
1083741417 11:64713453-64713475 CGACTTCCTGGAGCTGCTGCTGG - Exonic
1083755675 11:64790421-64790443 TGTCCACCTGGATCACCTGCTGG + Exonic
1083766613 11:64844479-64844501 CGGCCTCCTAGATCTGCTGCTGG - Exonic
1083934940 11:65865246-65865268 CGCGCACCTGCATCAGCTGCCGG - Exonic
1084032878 11:66491508-66491530 CAGCCACCAGGGGCAGATGCTGG + Exonic
1084179257 11:67438402-67438424 CTGCCGCCTGGAGGAGCAGCTGG - Exonic
1084506611 11:69572516-69572538 CGGGCTCCTGGGGAAGCTGCTGG + Intergenic
1085284801 11:75352418-75352440 CGGCCTCCTGCAGCCCCTGCTGG - Intergenic
1085346056 11:75768836-75768858 AGGACACCTGGAGCTGCGGCCGG - Exonic
1085455104 11:76661157-76661179 CGGCCTGCTGGAGCGGCTGCTGG - Exonic
1085455841 11:76664951-76664973 CTGCCTCCTGAAGCAGCTGCCGG + Intronic
1085642415 11:78200712-78200734 CAGCTGCCTGGAGCAGCTGGCGG + Exonic
1085666261 11:78417771-78417793 CGGGCAGCTGGGGCAGCGGCCGG + Exonic
1086669323 11:89527937-89527959 TGTCCACCTGGAAAAGCTGCAGG + Intergenic
1089442758 11:118530733-118530755 CGGACTCCTGGCGCGGCTGCAGG + Exonic
1090940636 11:131385056-131385078 TGGCCTCCAGGAGCATCTGCAGG - Intronic
1091588896 12:1831434-1831456 CCCCGACCTGCAGCAGCTGCAGG - Exonic
1093852584 12:24058870-24058892 CTGCCACCAGAAGCAGCAGCTGG - Intergenic
1094463470 12:30724375-30724397 GGGCTACCTGGAGTAGCTGAAGG + Exonic
1094835937 12:34322116-34322138 GGGCCCCATGCAGCAGCTGCTGG + Intergenic
1095292415 12:40490858-40490880 TGGACACCTGGACCATCTGCTGG + Exonic
1095488036 12:42704568-42704590 TGGAAACCTGGAGCAGCTGAGGG + Intergenic
1096670925 12:53197831-53197853 CGGCCAGCAGGAGGTGCTGCAGG - Exonic
1097235152 12:57534341-57534363 TTCCCACCTGGAGAAGCTGCTGG - Exonic
1101747938 12:107558369-107558391 GGGCATCCTGGAGCACCTGCAGG - Intronic
1101754123 12:107607684-107607706 TGGCCACCAGGGGGAGCTGCTGG - Intronic
1102203816 12:111076546-111076568 TGGCTCCTTGGAGCAGCTGCTGG - Intronic
1102647643 12:114414219-114414241 CGGCGTGCTGGAGCGGCTGCGGG + Intergenic
1103559933 12:121788387-121788409 AGGCAACCTGGAGGAGGTGCTGG - Intronic
1103924981 12:124418627-124418649 CGGCCACCTGGAGCTGCTCCGGG + Intronic
1103925562 12:124421890-124421912 CGGCCACCTGGAGCTGCTCCGGG + Intronic
1108771012 13:53700315-53700337 TGGGCACCTGGAAAAGCTGCAGG + Intergenic
1109142393 13:58730644-58730666 TGGCCCCTTGGAGCAGCTGCTGG + Intergenic
1110716269 13:78708031-78708053 CAGCAACGTGGAGCAGCTGGAGG - Intergenic
1113407749 13:110057208-110057230 TGGGCACACGGAGCAGCTGCGGG - Intergenic
1113800726 13:113085163-113085185 AGCCCACCTTGAGCAGCAGCTGG - Exonic
1113974885 13:114220173-114220195 CGGCCACCTTGACCTGCTGTTGG + Intergenic
1114665356 14:24374339-24374361 CCTCCACCTGGGGCAGCTCCTGG - Exonic
1117028984 14:51650971-51650993 CGCCCACCAGGACCTGCTGCTGG - Intronic
1118316004 14:64726554-64726576 GGCCCACCTGGAGCAGCCGGGGG - Intronic
1118316846 14:64730934-64730956 GGGCTACCTGGAGCAGCAGGTGG - Exonic
1119392080 14:74297756-74297778 AGGACTCCTGGAGAAGCTGCAGG - Intronic
1120268225 14:82277660-82277682 CTTCCACCTGGAAAAGCTGCAGG + Intergenic
1120463537 14:84826997-84827019 GGGCCACCGGGAGCTGCTGAGGG - Intergenic
1122451817 14:101814992-101815014 CAGCCACCAGCAGCAGCTTCGGG - Intronic
1122786481 14:104166514-104166536 CCCCCACCTGCAGCCGCTGCCGG - Intronic
1122803477 14:104244831-104244853 CTTCCACCTGCCGCAGCTGCAGG - Intergenic
1123940952 15:25216447-25216469 CTGGCACCTGGTGCTGCTGCAGG + Intergenic
1124532045 15:30516934-30516956 CCTCCACCTGCAGCTGCTGCTGG - Intergenic
1124593782 15:31077340-31077362 AGGCCACCTGGAGCAGAAGGAGG + Intronic
1124766608 15:32490711-32490733 CCTCCACCTGCAGCTGCTGCTGG + Intergenic
1125530556 15:40410650-40410672 GGGCTACCTGGAGCATGTGCTGG + Exonic
1125721620 15:41847788-41847810 CAACAACCAGGAGCAGCTGCTGG + Exonic
1125729215 15:41883347-41883369 CCACCAGCTGGAGGAGCTGCAGG - Exonic
1126837148 15:52679074-52679096 CGGTCACCTGAGGCAGCCGCGGG - Intronic
1128542655 15:68546550-68546572 GGGCCACCAGGAGCTGCTGTTGG + Intergenic
1128544762 15:68559554-68559576 CGGCCCGCTGGAAGAGCTGCAGG + Intergenic
1129294333 15:74591648-74591670 CGCCGCACTGGAGCAGCTGCGGG + Exonic
1131122926 15:89834231-89834253 CTGCCACCTGGGCCAGCTTCTGG - Exonic
1132333409 15:101027727-101027749 CAGGCAGCTGGAGCAGCTGGTGG + Exonic
1132588358 16:715779-715801 GGGCGCCCTGGAGCTGCTGCTGG + Exonic
1132734805 16:1379938-1379960 AGTCCGCCCGGAGCAGCTGCAGG - Intronic
1132757835 16:1494521-1494543 TGGCCGCCTGGAGGAGCTGTGGG + Exonic
1134050110 16:11131460-11131482 CGGCCTCCTGAAGCAGCCTCTGG - Intronic
1135423933 16:22323014-22323036 CCTCCACCTGGAGCCTCTGCCGG - Intronic
1136561605 16:31042362-31042384 GGGCCACCGGGAGGCGCTGCGGG - Intronic
1136630893 16:31488743-31488765 CGGCGACCGCGAGCTGCTGCTGG + Exonic
1137728186 16:50670901-50670923 TGGCCACATGGGGCAGCTTCAGG - Intronic
1138190668 16:55011057-55011079 GGCACAGCTGGAGCAGCTGCAGG + Intergenic
1138299849 16:55916851-55916873 TGGCAACCTGGACCAGCAGCTGG - Intronic
1139196492 16:64924828-64924850 TGGAAACCTGGAGCAGCTGAAGG + Intergenic
1139490905 16:67285431-67285453 TGGCAACCTGGAGAAGCTGCGGG + Exonic
1139505393 16:67395883-67395905 GGGACACCAGGAGCAGGTGCGGG - Intronic
1139668145 16:68472596-68472618 AGGCCAGCTGGAGCAGCTGAGGG + Intergenic
1139778932 16:69334895-69334917 CGGCCACCTGGACTCTCTGCTGG - Exonic
1142193158 16:88727076-88727098 CGACCGCCTGGAGCCGCTGCGGG - Exonic
1142200291 16:88757869-88757891 CTGCCTCCTGGGGCATCTGCTGG - Intronic
1142233738 16:88911749-88911771 CGGCCGCGTGGAGCTGGTGCAGG + Intronic
1142243253 16:88956653-88956675 AGGCCAGGTGGGGCAGCTGCAGG - Intronic
1142269514 16:89081873-89081895 GGGCCACAGGGAGCAGCTGCAGG - Intergenic
1142377166 16:89712054-89712076 CGGCCTCCTGGAGCCGCAGCCGG + Exonic
1142400067 16:89853991-89854013 CTGGGACCTAGAGCAGCTGCGGG + Intronic
1142631433 17:1228982-1229004 CCGCGACCTGGAGCAGCGGGAGG - Intronic
1144467695 17:15509363-15509385 GGGAGGCCTGGAGCAGCTGCTGG + Intronic
1144507932 17:15849239-15849261 CTACCACATGGAGCCGCTGCAGG + Intergenic
1144546147 17:16197758-16197780 CTTCCACCTGGAGCAGTTGCAGG - Intronic
1144676768 17:17167027-17167049 GGGACACCTGGAGAAGCTTCTGG - Intronic
1145172057 17:20666871-20666893 CTACCACATGGAGCGGCTGCAGG + Intergenic
1145819044 17:27817263-27817285 CTCCCAGATGGAGCAGCTGCTGG - Intronic
1147659298 17:42108686-42108708 CGGCCAGGGAGAGCAGCTGCAGG + Intronic
1147976953 17:44253304-44253326 CTTCCACCTGGACCTGCTGCTGG - Exonic
1149693168 17:58595626-58595648 AGGCCACCTGGAGGAGCTCAAGG + Intronic
1149891247 17:60392087-60392109 CGGCGACCGGGAGGAGCCGCCGG - Exonic
1150069744 17:62140471-62140493 GGGCCACGTGGAGCTGCTGGAGG - Intergenic
1151390851 17:73785824-73785846 GGGCCACGTGGAGCTGCAGCCGG + Intergenic
1151396998 17:73829857-73829879 AGGCCTGCTGGAGCAGCGGCCGG - Intergenic
1151730642 17:75909229-75909251 CAGCCACCTGCAGGACCTGCAGG - Intronic
1151819741 17:76491060-76491082 CTGCTTCCTGGACCAGCTGCAGG - Intronic
1152068636 17:78124610-78124632 AGGCCACCAGCAGCAGCAGCAGG + Exonic
1152290556 17:79437556-79437578 AGGCCACCAGGAGCAGGTGGAGG + Intronic
1152540507 17:80972101-80972123 CTTCCACCTTCAGCAGCTGCTGG + Intergenic
1152586008 17:81189804-81189826 CGACCACCTGGAGGAGCTGCTGG - Exonic
1152719734 17:81917692-81917714 CGACGACCCGGAGGAGCTGCGGG - Exonic
1152773967 17:82188337-82188359 AGCCCACGTGGAGCAGCTGCAGG - Exonic
1152781319 17:82228580-82228602 CGGCCGCCTGGCTCAGCTCCGGG - Intronic
1152944148 17:83189954-83189976 AGGGCCCCTGGAGCAGCTCCAGG - Intergenic
1153715520 18:7843924-7843946 GGACCACCTGGGGCTGCTGCTGG + Intronic
1155433376 18:25785635-25785657 AGGCCACCTGAAGGAGCAGCCGG - Intergenic
1157327562 18:46680036-46680058 CAGCCATCAGCAGCAGCTGCAGG + Exonic
1157718627 18:49906552-49906574 GGCCTACCTGGAGAAGCTGCGGG - Exonic
1158667879 18:59449236-59449258 CGGCCACCTAGAGGCACTGCTGG + Intronic
1160729141 19:632834-632856 GGGCCACGTGGAGCTGCTGGAGG - Exonic
1160808566 19:1003159-1003181 CAGCCCCCTGGAGACGCTGCTGG + Exonic
1160999997 19:1905745-1905767 GGGCCACCGGAAGCAGCTGGAGG - Intronic
1161014249 19:1975669-1975691 CTGCCCCCTGAATCAGCTGCAGG - Intronic
1161513281 19:4683309-4683331 CGGCCCCGTGGGGCTGCTGCAGG + Intronic
1161849433 19:6731012-6731034 CGTCCTCCTGGGGCAGCTGCAGG + Exonic
1162061931 19:8101388-8101410 CAGGCACCAGGAGGAGCTGCAGG - Intronic
1162728741 19:12705281-12705303 TGGTCACGTGGAGCAGCTGGTGG - Exonic
1162794595 19:13079999-13080021 CGGCCATCCTGAGCAGATGCTGG + Intronic
1162943854 19:14030893-14030915 CCCCCACTTGCAGCAGCTGCTGG - Exonic
1163062056 19:14768068-14768090 AGGCCACCAGAAGCAGATGCTGG - Intronic
1163355525 19:16808037-16808059 CAGCCACAAGGAGCAGCTGGTGG + Exonic
1163773021 19:19202135-19202157 GGGCAACCTGGGGAAGCTGCAGG + Intronic
1163830334 19:19544495-19544517 CGGCTCCGCGGAGCAGCTGCAGG + Exonic
1165809131 19:38600130-38600152 CTGCCCCCAGGAGCAGGTGCTGG + Exonic
1166091550 19:40512658-40512680 CGGCTGCCTGGCGGAGCTGCAGG + Exonic
1166101937 19:40576368-40576390 TGGCCGCCTGGAGAAGCCGCTGG + Exonic
1166107678 19:40605424-40605446 CGTCCACGTGGAGCACCCGCAGG + Exonic
1166762585 19:45234389-45234411 CGGGCAGCTGGAGGCGCTGCGGG - Intronic
1166890248 19:45987388-45987410 CGGCCACGTTCAGCAGATGCAGG - Intergenic
1166953038 19:46442987-46443009 CGGGGCCCTTGAGCAGCTGCTGG + Intergenic
1167018946 19:46860538-46860560 CTGCCAGCCGGCGCAGCTGCTGG - Intergenic
1167380384 19:49134826-49134848 CGGCCCCCAGGAGCAGCTCTTGG + Exonic
1167499155 19:49835838-49835860 GGCCCTCCTGGAGCAGCTTCTGG + Exonic
1167513405 19:49909011-49909033 AAGGCACCTGGAGCAGCTTCCGG - Exonic
1167551350 19:50163044-50163066 CTTCCAGTTGGAGCAGCTGCAGG - Exonic
1168096350 19:54117437-54117459 GGGCCACCTGGAGCATGGGCTGG + Intronic
1168300260 19:55401025-55401047 AGGCCACCAGGAGCAGCTCCAGG + Exonic
1168318999 19:55497884-55497906 CAGCCACCAGGCGCAGCTGGGGG - Exonic
1168416654 19:56173491-56173513 GGGGCGCCTGGAGGAGCTGCAGG + Intergenic
1168471207 19:56642756-56642778 CGACCGCCTGGGGCAGCGGCTGG - Intergenic
926166630 2:10525231-10525253 TCACCAGCTGGAGCAGCTGCCGG - Intergenic
927499605 2:23573942-23573964 CGGCCATCAGGACCATCTGCAGG + Intronic
927515864 2:23671367-23671389 CAGCCACCTGCAGCAGGTGACGG - Intronic
928388092 2:30886412-30886434 TGCCCACCTGGAGCAGCTGCTGG + Intergenic
929000697 2:37344770-37344792 CGGCCACCAGCAGCAGCAGGTGG - Exonic
929847286 2:45542534-45542556 AGCCCATCTGGAGCAGCTGCTGG - Intronic
930961434 2:57266876-57266898 CGTGCACCTGGAAAAGCTGCAGG - Intergenic
932817699 2:74874898-74874920 GGGCCTCCTGCTGCAGCTGCAGG + Intronic
933262755 2:80148572-80148594 AGGCCACCTGTCCCAGCTGCAGG + Intronic
933376095 2:81481726-81481748 CGGTCACATGGGGCAGCTGCCGG + Intergenic
933560091 2:83877385-83877407 CGTCCAGCTGGAGGAGCTGGAGG + Intergenic
934553881 2:95277467-95277489 CCGCCTCCTTGAGCTGCTGCAGG + Exonic
934661161 2:96144417-96144439 CGGAGAGCTGGAGCAGCAGCGGG + Intronic
936108928 2:109649030-109649052 CGGCGACCTGGACCAGTTGACGG + Intergenic
936283420 2:111162139-111162161 CGGCCGGCTGGAGCTGCTGTTGG - Intronic
936753750 2:115678725-115678747 CGTGCACCTGGAAAAGCTGCAGG + Intronic
937100367 2:119263868-119263890 CCTCCACCTGGGGCAGCAGCAGG + Exonic
938798348 2:134737564-134737586 CGGCCACCTTTAGAAGCTGGAGG - Intergenic
940639929 2:156334357-156334379 CGGCTTCCTGGGGCAGCCGCAGG - Intronic
941986685 2:171517638-171517660 CGTGGACCTGGACCAGCTGCTGG - Intergenic
944069961 2:195657437-195657459 CCGCCGACTGCAGCAGCTGCGGG - Intronic
944264126 2:197705768-197705790 CGGCCTCCTGGAAAAGCTGCTGG - Exonic
944681051 2:202077084-202077106 GGGTCACCTGGAGGAGCTGGGGG - Intronic
945794116 2:214340582-214340604 AGGCCTGCTGGAGCAGCAGCAGG - Intronic
946246016 2:218387868-218387890 CGGCCACCCCGAGCTGCTGCAGG + Exonic
947670196 2:231930856-231930878 AGGCCATCTGGAGCAGGTGCTGG - Intergenic
947875343 2:233464148-233464170 CCTCCGCCTGGAGCAGCAGCTGG + Exonic
948527061 2:238577505-238577527 AGGCCACCTGGAGCAGAACCAGG - Intergenic
948897546 2:240934334-240934356 AGGCCGCCTGCAGCAGCTGGAGG + Intronic
948897852 2:240935498-240935520 CGGACGCCTGGAGCAGCGGCAGG + Intronic
1169309199 20:4521190-4521212 GGCCCACCTGGAGCGGCTGCTGG + Intergenic
1169318038 20:4609305-4609327 CCGACACCTGGGGCAGGTGCAGG + Intergenic
1169488431 20:6052493-6052515 CGGCCACCTGGAGCAGCTGCAGG - Exonic
1170573660 20:17647091-17647113 TGGGCACCTGTAGCAGCAGCTGG - Intronic
1171484817 20:25479029-25479051 GGGCCTGCAGGAGCAGCTGCAGG - Exonic
1172507755 20:35476580-35476602 TGCTCACCTGGAGAAGCTGCTGG - Exonic
1173250667 20:41362707-41362729 GGCCCACCTGCAGCGGCTGCGGG - Exonic
1174579760 20:51563152-51563174 CAGCCGCCTGGAGCTCCTGCAGG - Intergenic
1174845580 20:53940070-53940092 CAGCCACGTGGGGGAGCTGCAGG - Intronic
1175203003 20:57290852-57290874 GGGCCAGGTGGAGCAGCAGCAGG - Intergenic
1175723786 20:61303320-61303342 CAGGCACCTGGACCAGCAGCAGG - Intronic
1176101595 20:63366933-63366955 AGGACACCTGTGGCAGCTGCTGG - Intronic
1179729790 21:43361258-43361280 AGGCCTCCAGGAGGAGCTGCGGG + Intergenic
1179888653 21:44325249-44325271 GGGCCACCTGCAGCAGGTGTGGG + Exonic
1179900595 21:44391496-44391518 GGGCCACGTGGTGCATCTGCAGG - Exonic
1179976918 21:44873526-44873548 CGGCCACCGGGATGAGCAGCAGG + Exonic
1180833531 22:18918617-18918639 AGGGCACCTGGAGCAGGTGTGGG + Intronic
1181403486 22:22665849-22665871 AGGACACCTGGATCAGCTCCTGG + Intergenic
1181408490 22:22701833-22701855 AGGACACCTGGATCAGCTCCTGG + Intergenic
1182230760 22:28835913-28835935 GGGCCTCCCGGAGCTGCTGCTGG + Intergenic
1182829395 22:33292447-33292469 GGGCAACCTCAAGCAGCTGCAGG + Intronic
1183059489 22:35327366-35327388 CGCAGACCTGGAGCTGCTGCAGG + Exonic
1183279196 22:36923112-36923134 TGGCCACCTGGTGCCTCTGCAGG + Intronic
1183459391 22:37940857-37940879 CCCCCTCCTGGAGCAGCTCCTGG + Exonic
1183625575 22:38999452-38999474 AGGTCACCTGGAGCATCTCCTGG + Intergenic
1183931485 22:41238288-41238310 CGGCCTGCGGGAGCTGCTGCTGG - Exonic
1184235490 22:43180870-43180892 CGGGCACCTGCTGCAGCTGCTGG + Exonic
1184684397 22:46089606-46089628 GGCCCACCTGGAGGGGCTGCTGG + Intronic
1184800439 22:46755678-46755700 CCTACACCTGGAGAAGCTGCAGG - Intergenic
1185232278 22:49690020-49690042 GTGCCCCCTGGAGCGGCTGCAGG - Intergenic
1203283616 22_KI270734v1_random:143915-143937 AGGGCACCTGGAGCAGGTGTGGG + Intergenic
950695906 3:14701095-14701117 AGGCCACCTGGAGCATCTGCTGG - Intronic
952178670 3:30894703-30894725 CGGCTGCCTGGTGCACCTGCGGG - Exonic
953454190 3:43029123-43029145 CATCCACCTGAAGCTGCTGCTGG - Intronic
953769652 3:45770295-45770317 CAGCAACCTGGAGCAGGTGAAGG - Exonic
954401791 3:50322956-50322978 CTGTCACCTGGCGCAGCTGGCGG - Intronic
954745706 3:52786443-52786465 TGCCCACCTGGGGCAGCTGCAGG - Intronic
954808308 3:53232788-53232810 CGGCCACCTGCTCCAGCTGAAGG - Intronic
954967780 3:54626268-54626290 CGTGGACCTGGACCAGCTGCTGG + Intronic
955407193 3:58633007-58633029 CAGCCTCCTGGAGCATGTGCTGG - Intergenic
961682412 3:128608074-128608096 CGCTGACCTGGAGCACCTGCAGG - Intergenic
963168045 3:142225181-142225203 CGGCCACCTGCAGCACCCGCGGG - Intronic
963602527 3:147390704-147390726 CGGCCACCTGTAATAGTTGCTGG - Intronic
963947657 3:151163973-151163995 GGGCCACCTGCAGCAGATCCAGG - Exonic
964732639 3:159883482-159883504 GGGCCACCTGGTGCTGCTGAAGG - Intronic
968704875 4:2073158-2073180 CGGTCACCTGAACCAGCTGTGGG + Intronic
968908239 4:3464173-3464195 CTGTCCTCTGGAGCAGCTGCAGG - Intronic
969294676 4:6262940-6262962 CGGCTCCCTGGAGGAGGTGCTGG - Intergenic
970333160 4:15004269-15004291 CCGCCGCCTGGTGCTGCTGCTGG - Exonic
974626252 4:64431613-64431635 CGGCTACCAGGGGCAGATGCTGG + Intergenic
975585062 4:75940886-75940908 CGGCCAGCAGCAGCAGCAGCAGG + Exonic
978344515 4:107753214-107753236 TGGCAGCCTGGAACAGCTGCGGG - Intergenic
978879548 4:113685099-113685121 CTGCCATCTGGAGAGGCTGCTGG - Intronic
980324519 4:131324318-131324340 CGTGCACCTGGAGAAGCTGTAGG + Intergenic
981049628 4:140297363-140297385 CGGCCACCTCGAGGAGAAGCAGG + Intronic
982520956 4:156416446-156416468 CGTGCACCTGGAAAAGCTGCAGG - Intergenic
985493462 5:192216-192238 GGGCCACGTGCAGCAGCTTCTGG + Exonic
985590206 5:760586-760608 CGGCCACCTGGTGATGCTGAGGG + Intronic
985645232 5:1081819-1081841 CGGCCACCAGTGGCACCTGCCGG - Intronic
985731511 5:1551969-1551991 CTGCCAACAGGAGCAGGTGCGGG - Intergenic
985733190 5:1563064-1563086 GGCCCAGCTGGAGCTGCTGCGGG - Intergenic
985779893 5:1865018-1865040 CCTCCACCTGGAGAACCTGCAGG + Intergenic
985798657 5:1985878-1985900 AGTCCACCTGGAGCATCTGCTGG - Intergenic
986516920 5:8574098-8574120 GAACAACCTGGAGCAGCTGCTGG - Intergenic
987875276 5:23674292-23674314 AGGCCATCTGGAATAGCTGCTGG + Intergenic
991298170 5:65103031-65103053 CGGCCGCCGGGAGCGGCTGTGGG + Intergenic
992503854 5:77366659-77366681 TGGCCTCATGGAGCTGCTGCAGG - Intronic
992584509 5:78222208-78222230 CAGCAACCTGCAGCAGCTACTGG - Intronic
994043408 5:95283942-95283964 CGCCTGCCTGGAGCAGCTGCTGG - Exonic
994072776 5:95620647-95620669 CGGATGCCTGCAGCAGCTGCAGG - Exonic
997004948 5:129805563-129805585 CGGCCATCTTGATCAGCTTCAGG + Intergenic
998451136 5:142235556-142235578 CGACCAGCTGGAGCAGCAGAAGG - Intergenic
998487742 5:142517627-142517649 CGTGCACCTGGAAAAGCTGCAGG + Intergenic
1001236527 5:170034468-170034490 AGGCCTCCTGGAGAAGCTGCTGG + Exonic
1001589925 5:172858234-172858256 CGGCCGGCTGAAGCGGCTGCTGG + Intronic
1001936717 5:175710630-175710652 AGGCCTCCTGGAGCCTCTGCTGG + Intergenic
1002173716 5:177389735-177389757 CGGCCACCTACTGCAGCTTCCGG + Intronic
1002211969 5:177604610-177604632 AGGCCACCTGGGGCAGGGGCAGG + Intronic
1002535849 5:179874942-179874964 CGCCAACATGGAGCAGCTGCTGG - Exonic
1003044829 6:2724219-2724241 CGCCCATCTGTAGCAGATGCTGG - Intronic
1003345307 6:5261030-5261052 CCGCCGCGTGGAGCGGCTGCTGG - Exonic
1003442921 6:6159904-6159926 GGCCCACCTGGAACAGCTCCAGG - Intronic
1004518275 6:16339181-16339203 AGGCCTCCTGGAGCAGTTGCTGG - Intronic
1005418595 6:25626919-25626941 GGGCCACATGGAGAAGCAGCAGG + Intergenic
1005710566 6:28500252-28500274 TGGTCACCTGGAGCAACTGCAGG + Intergenic
1006131133 6:31870198-31870220 AAGCCACCTGGGGCAGCTTCGGG + Intronic
1006364185 6:33605528-33605550 CGCTCACCAGGAGCAGATGCTGG - Intergenic
1006750664 6:36374731-36374753 GAGCCTCCTGTAGCAGCTGCTGG - Intronic
1006903419 6:37517267-37517289 AGGCTGCCTGCAGCAGCTGCAGG + Intergenic
1008265042 6:49414616-49414638 GGGCCACATGGAGGAGCTGTGGG + Intergenic
1009418854 6:63443259-63443281 CGCCCACCTGGAACTGGTGCTGG + Intergenic
1010428261 6:75749496-75749518 GGGCCTCCTCGAGCAGCTCCGGG + Intronic
1011192130 6:84740177-84740199 AGGCCAGGTGGAGCAGGTGCAGG - Intronic
1012765622 6:103363431-103363453 CGTGCACCTGGAAAAGCTGCAGG + Intergenic
1013538788 6:111087675-111087697 CGGGCTCCCGGAGGAGCTGCGGG - Exonic
1015347898 6:132180756-132180778 CAGCCACCCAGAGAAGCTGCTGG - Intergenic
1018400520 6:163415307-163415329 CAACCACCTCGAGCGGCTGCTGG + Exonic
1018442093 6:163822753-163822775 CAGCCACCTGGAGCATCTGAAGG - Intergenic
1018591071 6:165423368-165423390 CGGCCAGGTGGCTCAGCTGCTGG - Intronic
1018613445 6:165663462-165663484 CGCACAGCTGGAGCAGCTGCAGG - Intronic
1018963081 6:168462485-168462507 CACCCTCCTGGAGCAGCAGCCGG - Intronic
1019477496 7:1251107-1251129 CCGCCAGCAGGAGAAGCTGCTGG + Intergenic
1020005466 7:4781715-4781737 AGGCCACCAGGCTCAGCTGCCGG - Exonic
1020012698 7:4815382-4815404 CGCCCGCCTGCAGCAGCTCCTGG - Exonic
1020117034 7:5481726-5481748 CAGTCACCTCGAGAAGCTGCAGG - Exonic
1020445510 7:8262573-8262595 TGGCCACGTGGAACACCTGCCGG - Intronic
1021900128 7:25276861-25276883 CACTGACCTGGAGCAGCTGCTGG + Intergenic
1022723034 7:32957615-32957637 CGGTCACCCAGAGCAGCAGCAGG - Exonic
1024300444 7:47883524-47883546 AGGCCACATGGGGAAGCTGCAGG - Intronic
1024934460 7:54698553-54698575 CATCCACCTGGAGCAGCACCTGG - Intergenic
1026916016 7:74120853-74120875 GGGCCCCCTGGAGTAACTGCCGG + Intronic
1029054938 7:97732242-97732264 CGGCCACCTCGGACAGATGCGGG - Intronic
1029110942 7:98212768-98212790 CAGCCACCTGCTGCTGCTGCTGG - Exonic
1029149913 7:98472543-98472565 CTGCACCCAGGAGCAGCTGCGGG + Intergenic
1029735960 7:102465904-102465926 CAACCACCTGGAGACGCTGCCGG + Exonic
1030197560 7:106867753-106867775 CGGCAACGTGGAGCAGATGAAGG + Exonic
1031186739 7:118490958-118490980 GGGTCACCTGAAGCATCTGCTGG + Intergenic
1033672319 7:143504894-143504916 TGGCCACCAGGAGCAGCTGAGGG + Intergenic
1034383694 7:150720598-150720620 AGCCCAGGTGGAGCAGCTGCTGG + Exonic
1034557617 7:151860034-151860056 CGGGCACCTGGAGCTGTAGCAGG + Intronic
1034572824 7:151970658-151970680 CCCCCACCAGGAGCAGATGCTGG + Intronic
1035642521 8:1194690-1194712 AGGACACCTGAAGCAGCTCCGGG - Intergenic
1035673332 8:1436766-1436788 CGGTCACCCAGAGCAGCTTCGGG + Intergenic
1035835680 8:2749415-2749437 GGGCCACTTGAAGTAGCTGCGGG + Intergenic
1036453936 8:8892446-8892468 CCACCAGCTGCAGCAGCTGCCGG + Exonic
1037922627 8:22818222-22818244 CTGGCACCTAGAGCAGCTTCTGG - Intronic
1038452964 8:27651584-27651606 CGGCCACCAGGAGCAGGGCCAGG - Exonic
1038979929 8:32748643-32748665 CAGCCACTTGGAGGACCTGCAGG - Intronic
1039271457 8:35885510-35885532 GGAACAGCTGGAGCAGCTGCAGG + Intergenic
1039433756 8:37545626-37545648 CGGACACCTGGCCCTGCTGCTGG - Intergenic
1040097397 8:43459538-43459560 AGGCCTCCTGGAGCTGCTGTGGG + Intergenic
1040504478 8:48034935-48034957 TGGCCACCTGGAGAGGCTGCAGG - Intronic
1040512598 8:48108373-48108395 CGGCAAGCTGGGGCGGCTGCGGG - Intergenic
1040529880 8:48258007-48258029 GGGCAGCCTGGAGCAGGTGCAGG + Intergenic
1040737681 8:50530170-50530192 TGGTCACTTGGAGCACCTGCAGG - Exonic
1043161552 8:76853209-76853231 CGTCCATCTGTGGCAGCTGCAGG - Exonic
1043438901 8:80259867-80259889 TGGCCACCTTGGGCACCTGCAGG + Intergenic
1045368910 8:101501586-101501608 CGGCCAGCAGGGGCTGCTGCCGG + Intronic
1047423738 8:124727750-124727772 CGGCCACCTGCGGGAGCTCCCGG - Intronic
1047434346 8:124823533-124823555 AGGCCACCTGGGGAAGCTGAGGG + Intergenic
1048100009 8:131341059-131341081 CAGCCACATGGCCCAGCTGCTGG - Intergenic
1049248048 8:141573164-141573186 CGGGCACCTGGACCAGCCTCAGG - Intergenic
1049273469 8:141708186-141708208 GGGCCCCCCGCAGCAGCTGCAGG + Intergenic
1049425616 8:142536714-142536736 CAGCCACCGAGAGCTGCTGCAGG - Intronic
1049499117 8:142952090-142952112 TGGGAACATGGAGCAGCTGCTGG - Intergenic
1049671515 8:143872176-143872198 CGGCCACCAGGAGCTGCTCATGG + Exonic
1049752012 8:144289397-144289419 AGGCCACATGGAGCTGCTGGTGG - Intronic
1049802708 8:144525601-144525623 AGGCCAGCAGGAGCAGGTGCTGG - Intronic
1049998416 9:1051838-1051860 CGGCCAGCCGGAGCAGCGGGGGG + Exonic
1050253513 9:3770633-3770655 GGGTAACCTGGAGCTGCTGCAGG - Intergenic
1053392619 9:37746514-37746536 CGGCCAGCTGGACCAGGTGCTGG - Exonic
1054723918 9:68631199-68631221 CAGACACCTGGAGCAGCTCTGGG + Intergenic
1054938879 9:70718131-70718153 ACCCCACCTGGAGCAGGTGCTGG + Intronic
1054940570 9:70736124-70736146 ACCCCACCTGGAGCAGGTGCTGG + Intronic
1055187766 9:73475741-73475763 CAGCCACCAGGAGCAAATGCTGG - Intergenic
1057719321 9:97519485-97519507 GGGTCACCAGGAGCTGCTGCAGG + Intronic
1057719324 9:97519491-97519513 GGCCCACCTGCAGCAGCTCCTGG - Intronic
1057836005 9:98445793-98445815 GGGGCACCTGCAGCAGCTGGGGG + Intronic
1059391615 9:114002742-114002764 AGGCCACCTGGAGCAGTTCTGGG - Intronic
1060055456 9:120409152-120409174 GGACCTCCTGGATCAGCTGCTGG + Exonic
1060442487 9:123654888-123654910 GGGGCCCCAGGAGCAGCTGCAGG + Intronic
1061050182 9:128190722-128190744 GGGACTGCTGGAGCAGCTGCTGG + Exonic
1061720218 9:132546741-132546763 CAGCCACCAGGGGCAGTTGCTGG - Intronic
1062271374 9:135711283-135711305 TGGCCACCGGGAACAGATGCAGG + Intronic
1062389590 9:136328572-136328594 CGCCCCCCGGGATCAGCTGCTGG - Intronic
1062390615 9:136332255-136332277 CACCCACCTGGTGCAGCTGCAGG + Intronic
1062453703 9:136626190-136626212 GGGCCAGCTGGAGCGGGTGCAGG + Intergenic
1185726708 X:2427445-2427467 GGGTCTCCTGAAGCAGCTGCAGG + Intronic
1185748282 X:2589453-2589475 TGTCCACCTGGAGCAGATTCTGG - Intergenic
1189010653 X:37043208-37043230 TGGCCAGCTGGTGCAGCTCCAGG + Intergenic
1189014140 X:37078035-37078057 AGGCCAGCTGGTGCAGCTCCAGG + Intergenic
1189035750 X:37492347-37492369 TGGCCAGCTGGTGCAGCTCCAGG - Intronic
1189037235 X:37505660-37505682 TGGCCAGCTGGTGCAGCTCCAGG - Intronic
1190362915 X:49666143-49666165 TGGCCTAGTGGAGCAGCTGCGGG - Intergenic
1190713338 X:53084739-53084761 CCCCCACCTGGAGCAGGTACAGG + Exonic
1190931300 X:54951343-54951365 GGGCTTCCTGGAGCAGGTGCTGG + Intronic
1194418144 X:93638232-93638254 CGTGCACCTGGAAAAGCTGCAGG + Intergenic
1196390601 X:115203806-115203828 CGAGCACCTGGAAAAGCTGCAGG - Intronic
1196746287 X:119073792-119073814 CGGCCTCCTGGAGCAGGCCCAGG - Intergenic
1200134904 X:153870137-153870159 CGCCCACTTTCAGCAGCTGCAGG + Exonic