ID: 1169488619

View in Genome Browser
Species Human (GRCh38)
Location 20:6053463-6053485
Sequence CTGGGCAGGGCTAATACTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 121}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169488619_1169488631 6 Left 1169488619 20:6053463-6053485 CCCCCAGTATTAGCCCTGCCCAG 0: 1
1: 0
2: 0
3: 10
4: 121
Right 1169488631 20:6053492-6053514 TGGCTGAGAGCTGCTAGTTGTGG 0: 1
1: 0
2: 0
3: 14
4: 161
1169488619_1169488634 26 Left 1169488619 20:6053463-6053485 CCCCCAGTATTAGCCCTGCCCAG 0: 1
1: 0
2: 0
3: 10
4: 121
Right 1169488634 20:6053512-6053534 TGGAATTTCTGGACTACCTAGGG 0: 1
1: 0
2: 2
3: 7
4: 112
1169488619_1169488633 25 Left 1169488619 20:6053463-6053485 CCCCCAGTATTAGCCCTGCCCAG 0: 1
1: 0
2: 0
3: 10
4: 121
Right 1169488633 20:6053511-6053533 GTGGAATTTCTGGACTACCTAGG 0: 1
1: 0
2: 1
3: 8
4: 131
1169488619_1169488632 15 Left 1169488619 20:6053463-6053485 CCCCCAGTATTAGCCCTGCCCAG 0: 1
1: 0
2: 0
3: 10
4: 121
Right 1169488632 20:6053501-6053523 GCTGCTAGTTGTGGAATTTCTGG 0: 1
1: 0
2: 0
3: 14
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169488619 Original CRISPR CTGGGCAGGGCTAATACTGG GGG (reversed) Intronic
900522892 1:3114785-3114807 CTGGGCAGGGCTGGGAGTGGTGG - Intronic
901196216 1:7441391-7441413 CTGGGCTGGGCCAGTCCTGGGGG + Intronic
902470764 1:16646527-16646549 CTGGGCATAGATAAGACTGGGGG + Intergenic
904808340 1:33147116-33147138 CTGGGCAGGGCTCTTGCAGGTGG + Exonic
905521661 1:38605232-38605254 CTGGGCAGGGCCAGTGCTGAGGG - Intergenic
905750116 1:40454767-40454789 CTGTGGAGGGTTACTACTGGTGG - Intronic
905832967 1:41089074-41089096 CTGGGCAGTGCTGATGCTGCTGG + Intronic
906710960 1:47929727-47929749 CTGGGCAGGGTTAGCACTGGAGG + Intronic
908455445 1:64299516-64299538 CTTTGCGGGGCTAATGCTGGAGG - Intergenic
912542351 1:110426571-110426593 GTTGGCATTGCTAATACTGGGGG - Intergenic
913713445 1:121510672-121510694 CTAGGCAGGGATAATAGAGGAGG - Intergenic
914702682 1:150149463-150149485 CTGGGCAGGTCAGATGCTGGGGG - Intronic
915276991 1:154795895-154795917 CAGGGCAGGGCCAATTCTGGAGG + Intronic
915554906 1:156656020-156656042 TTGGGCTGGGCTCACACTGGTGG + Intronic
917977211 1:180247843-180247865 CTGGGCAGGGCTCACTTTGGGGG + Intronic
919012902 1:191988279-191988301 CTTGGCAGGGAGACTACTGGTGG - Intergenic
919757120 1:201073213-201073235 CAGGGCAGGGCTAGCAATGGTGG + Intronic
921793784 1:219319501-219319523 CTGCGAAGGGCCAATTCTGGGGG + Intergenic
1063275884 10:4567515-4567537 CTGCTCAGGGCTAAGACTGGTGG - Intergenic
1080580956 11:33643335-33643357 CTGGGGTGGGGTAGTACTGGGGG - Intronic
1081484090 11:43514863-43514885 CTGGGCTGGGCTCATTGTGGGGG - Intergenic
1083293896 11:61705019-61705041 CTGGGCTGAGCTGAGACTGGGGG + Intronic
1083301075 11:61739889-61739911 CAGGGAAGGGCTGACACTGGAGG - Intronic
1084322360 11:68380717-68380739 CGGGGCAGTGCCAATGCTGGTGG + Intronic
1085338908 11:75718653-75718675 CTGGGCTGGGCTCACACTGGAGG + Intronic
1088725780 11:112633395-112633417 CTAGGCAGGGACAATTCTGGGGG - Intergenic
1095380675 12:41587453-41587475 CTGGGTAAGGCCAATACTGTGGG - Intergenic
1101324899 12:103706821-103706843 CTGGGCAGGGCTGGCATTGGGGG - Exonic
1101883149 12:108639555-108639577 CTGGGAAGGGCAGACACTGGAGG + Intergenic
1108226496 13:48294849-48294871 CTGGGCAGGGCCCATACAGTTGG + Intergenic
1109893923 13:68656973-68656995 CTGTGGAGGGCTAAGGCTGGAGG + Intergenic
1113281154 13:108789390-108789412 AGGGGGAGGGCTAATACTGGGGG - Intronic
1114409367 14:22486218-22486240 CAGTGCAGTGCTAATGCTGGTGG + Intergenic
1114615697 14:24067157-24067179 CTGAGAAGGACTAATACTGCAGG - Intronic
1125724544 15:41861643-41861665 CTGGTCAAGGCTAAGACTGGAGG - Intronic
1125768823 15:42151974-42151996 CTGGGCAGGACTCATCCTGCAGG + Intronic
1125889196 15:43253077-43253099 CTGGGGAGGGCTAAGGATGGGGG + Intronic
1127563493 15:60163705-60163727 CTGGGCATGGCACTTACTGGTGG - Intergenic
1129661350 15:77554706-77554728 CTGGCCAGGGCTCATCCTGGGGG + Intergenic
1131112263 15:89772405-89772427 CTAGGCAGGTCTCATACTGCTGG - Intronic
1132006804 15:98234845-98234867 CTGGGCACTGCTGATAATGGGGG - Intergenic
1132221394 15:100108119-100108141 TTGGGCAGGGTTAATGCAGGTGG + Intronic
1135839591 16:25862874-25862896 GTGGGTGGGGCTAAAACTGGGGG - Intronic
1137732236 16:50697477-50697499 CTGGGCAGGGTCAATGGTGGGGG + Intronic
1149990148 17:61378611-61378633 CTGGGCAGGGAGAAGGCTGGTGG - Intronic
1156375016 18:36505858-36505880 CTGGGCTGTGCTAATGCTGCAGG + Intronic
1156919868 18:42508647-42508669 ATGAGCAGGGCTGATACTGTTGG - Intergenic
1157177373 18:45463927-45463949 GTGGGCAGGGCTAATCCTCCTGG - Intronic
1159812613 18:73034630-73034652 CTTTGCAAGGCTAATACAGGAGG - Intergenic
1160826317 19:1082120-1082142 CAGGGCAGGGCTGAGGCTGGGGG + Intronic
1166076143 19:40414807-40414829 CTGGGCTGGGCTGAGGCTGGGGG + Intergenic
1166965309 19:46526295-46526317 CCGGGCAGGGGTGATGCTGGTGG + Intronic
1167659928 19:50790559-50790581 CTGGTCAGGGCTAGCCCTGGGGG - Intronic
1168468526 19:56622764-56622786 CTGTGCAGGGCTCTCACTGGCGG + Exonic
1168701053 19:58439808-58439830 CTGGGCAGGGCCATAACAGGAGG + Exonic
1168723366 19:58567315-58567337 CTGGGCAGGGCTGCTGCTGTGGG + Intronic
925115695 2:1376576-1376598 CAGGGCAGTGCTGATAGTGGAGG + Intronic
925177248 2:1794280-1794302 CTGGGCTGGGCTCATCCAGGAGG - Intronic
925297863 2:2790093-2790115 CTGGGCAGAGCAAATCCTGCGGG - Intergenic
933750536 2:85600048-85600070 CTGGGCAGGGCCAGGGCTGGAGG - Intronic
934639755 2:96020765-96020787 CTGGGCAGGGCCAAGCGTGGTGG - Intergenic
935763633 2:106343590-106343612 CTGGGCAGGGCTACCAGGGGTGG - Intergenic
937026377 2:118701373-118701395 CTGGGTAGCGCAAATTCTGGAGG + Intergenic
937045443 2:118848821-118848843 CTAGCCAGGGCAAATACTTGGGG - Intergenic
940037280 2:149324101-149324123 CTCAGCATGGCTCATACTGGGGG - Intergenic
944931128 2:204520793-204520815 CTGGGGAGGCCTATAACTGGAGG + Intergenic
948660154 2:239501955-239501977 CTGGGCAGGGCTGCAGCTGGGGG - Intergenic
948686933 2:239675718-239675740 CTGGGCAGGGCTGGTACTCAGGG - Intergenic
948699339 2:239750530-239750552 CTGGGCAGGGCCAAGCCAGGCGG + Intergenic
1169488619 20:6053463-6053485 CTGGGCAGGGCTAATACTGGGGG - Intronic
1180977291 22:19855314-19855336 CGGGGCCGGGCTAAGCCTGGGGG + Intergenic
1183050141 22:35254283-35254305 CTGGGCAGGCCTAGTCATGGTGG - Intergenic
950440370 3:13006886-13006908 CTGGGCCGGGCTCTGACTGGCGG + Intronic
950640248 3:14344031-14344053 CTGGAGAGGGGTAAGACTGGAGG + Intergenic
950723081 3:14898559-14898581 CAGGGCCGGGCTAATCCAGGAGG + Intronic
951057393 3:18163443-18163465 CTGGGCAAAGGTATTACTGGAGG - Intronic
952674642 3:36013016-36013038 AGGGGCAGGGATAATTCTGGAGG - Intergenic
954154054 3:48674957-48674979 CTGGGCAGGCCACATACTTGGGG - Intronic
954456956 3:50604833-50604855 CAGGGCAGAGCTAACCCTGGGGG - Intergenic
955712834 3:61798150-61798172 CTGGGCAGGGTTAATCTTTGTGG - Intronic
957085365 3:75672114-75672136 CTGGGCCGGGCTAGAACAGGAGG + Intergenic
960089846 3:113628073-113628095 CTGGGCAGGGTGACAACTGGAGG - Exonic
964620049 3:158712132-158712154 TTGGGCAGGGCCAAGACTAGTGG - Intronic
968983492 4:3863353-3863375 CTGGGCAGGGCTATGACCAGAGG + Intergenic
969193806 4:5544860-5544882 GTGGGCAGGGCTGGTGCTGGGGG - Intronic
969577965 4:8047408-8047430 CTGGGCAGGCCTCATAGAGGAGG - Intronic
971753459 4:30679333-30679355 CTGGGGAGGTCTCATAATGGTGG - Intergenic
972344243 4:38179390-38179412 TTTGGCAGGGCTAGTACTAGGGG + Intergenic
977900280 4:102414685-102414707 GTGGCCAGGTTTAATACTGGTGG - Intronic
978329167 4:107593474-107593496 CTGGGCTGTGCTAATGCTGCAGG + Intronic
985125048 4:186684701-186684723 CTGTGCTGCGTTAATACTGGTGG - Intronic
985445593 4:190019583-190019605 CTGGGCCGGGCTAGAACAGGGGG - Intergenic
989964433 5:50451481-50451503 CTGGGCAGGGATATTAGAGGAGG + Intergenic
997164157 5:131640665-131640687 CTGGGCAGAGTTAGTCCTGGGGG - Intronic
999252554 5:150191055-150191077 ATGGGGAGGGGGAATACTGGGGG + Intronic
999652904 5:153784874-153784896 TTAGGCAGGACTAGTACTGGTGG - Intronic
999711133 5:154319647-154319669 CTGGGCATGGCTACCACTGTGGG - Intronic
1003642547 6:7887877-7887899 CTGGGCAGGGCTGCCACTGAGGG - Intronic
1004788841 6:19000490-19000512 CAGGGCAGGACTAGTGCTGGCGG - Intergenic
1006478345 6:34272506-34272528 CTGGGCAGGGCCAAGGCTAGGGG + Intergenic
1011698281 6:89932690-89932712 GGGCGCAGGGTTAATACTGGAGG + Exonic
1013467564 6:110430778-110430800 CTGGGCAAGGCGAATTCTGGGGG - Intronic
1014182195 6:118397413-118397435 CTGGGAAGGTCTCTTACTGGAGG - Intergenic
1018673337 6:166197671-166197693 CTGGCCAGGGCTGACTCTGGAGG + Intergenic
1021243910 7:18238465-18238487 CTGCGCTGGGGAAATACTGGAGG - Intronic
1026194204 7:68158431-68158453 CAGGGCATGGACAATACTGGAGG - Intergenic
1028598185 7:92569042-92569064 CTGGGCAGGACTGATACAGGAGG + Intronic
1033086292 7:138345097-138345119 CTCAGCATGGCTCATACTGGGGG - Intergenic
1035346720 7:158204956-158204978 CTGGGCATGTCTCTTACTGGAGG + Intronic
1037764002 8:21760692-21760714 CTTGGCATGGTTGATACTGGAGG + Intronic
1037987939 8:23301311-23301333 CTGGCCAGGGCTCTAACTGGGGG - Intronic
1038205222 8:25458793-25458815 GTGGGCGGGGCTAACGCTGGAGG - Intergenic
1038768415 8:30452393-30452415 CTGGGCAGGGCTGGGATTGGGGG + Intronic
1040616950 8:49046659-49046681 CTGGGTAGGGCTGATTATGGAGG + Intergenic
1042497019 8:69466650-69466672 GAGGGCAGGGCTGAAACTGGAGG - Exonic
1046761910 8:118030276-118030298 CTGGGCAGGGCTGACACAAGAGG + Intronic
1048439104 8:134446849-134446871 CTTGGCAGGGCTTGAACTGGAGG + Intergenic
1051306832 9:15718602-15718624 CTGTGCTGAGCTAAAACTGGGGG - Intronic
1056543402 9:87593470-87593492 CTGAGCAGGGTGAATATTGGAGG + Intronic
1057199681 9:93133518-93133540 CCGGGCAGGGCAAGTTCTGGAGG + Intronic
1057210660 9:93199338-93199360 CTGGGCAGGGCTAAGGTAGGAGG - Intronic
1060695604 9:125706872-125706894 CCGGGCAGCGCTGAAACTGGAGG + Intronic
1061226519 9:129283861-129283883 CTGGGCAAGGCCAATGCTGCTGG + Intergenic
1061369153 9:130188068-130188090 ATGGCCAGGGCTAATAACGGGGG - Intronic
1185759932 X:2682908-2682930 TTGGGGAGGGCTGAGACTGGGGG + Intergenic
1198128972 X:133675276-133675298 CTGGGTAGGGCTAATTCTGCAGG - Intronic
1200829699 Y:7678744-7678766 CTGTGCACAGCTAATACTGCTGG + Intergenic
1201064922 Y:10088651-10088673 CTGGGCCGGGCTAGAACAGGGGG + Intergenic
1202282668 Y:23206591-23206613 CAGGGAATGGCTAATAATGGTGG - Intergenic
1202283223 Y:23211928-23211950 CAGGGAATGGCTAATAATGGTGG + Intergenic
1202434342 Y:24820976-24820998 CAGGGAATGGCTAATAATGGTGG - Intergenic
1202434897 Y:24826314-24826336 CAGGGAATGGCTAATAATGGTGG + Intergenic