ID: 1169498004

View in Genome Browser
Species Human (GRCh38)
Location 20:6133244-6133266
Sequence GCTGCTGGAGCCTCACGACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169497997_1169498004 -2 Left 1169497997 20:6133223-6133245 CCAACCCACCAACCCACGTGTGC No data
Right 1169498004 20:6133244-6133266 GCTGCTGGAGCCTCACGACCTGG No data
1169497998_1169498004 -6 Left 1169497998 20:6133227-6133249 CCCACCAACCCACGTGTGCTGCT No data
Right 1169498004 20:6133244-6133266 GCTGCTGGAGCCTCACGACCTGG No data
1169497996_1169498004 4 Left 1169497996 20:6133217-6133239 CCAGCACCAACCCACCAACCCAC No data
Right 1169498004 20:6133244-6133266 GCTGCTGGAGCCTCACGACCTGG No data
1169498001_1169498004 -10 Left 1169498001 20:6133231-6133253 CCAACCCACGTGTGCTGCTGGAG No data
Right 1169498004 20:6133244-6133266 GCTGCTGGAGCCTCACGACCTGG No data
1169497994_1169498004 6 Left 1169497994 20:6133215-6133237 CCCCAGCACCAACCCACCAACCC No data
Right 1169498004 20:6133244-6133266 GCTGCTGGAGCCTCACGACCTGG No data
1169497995_1169498004 5 Left 1169497995 20:6133216-6133238 CCCAGCACCAACCCACCAACCCA No data
Right 1169498004 20:6133244-6133266 GCTGCTGGAGCCTCACGACCTGG No data
1169497999_1169498004 -7 Left 1169497999 20:6133228-6133250 CCACCAACCCACGTGTGCTGCTG No data
Right 1169498004 20:6133244-6133266 GCTGCTGGAGCCTCACGACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169498004 Original CRISPR GCTGCTGGAGCCTCACGACC TGG Intergenic
No off target data available for this crispr