ID: 1169502355

View in Genome Browser
Species Human (GRCh38)
Location 20:6173158-6173180
Sequence TTAGCTACTTCAAGTTTGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169502355_1169502360 18 Left 1169502355 20:6173158-6173180 CCCCCCAAACTTGAAGTAGCTAA No data
Right 1169502360 20:6173199-6173221 ATTTTCTAGTTTCTGTGATCAGG No data
1169502355_1169502361 25 Left 1169502355 20:6173158-6173180 CCCCCCAAACTTGAAGTAGCTAA No data
Right 1169502361 20:6173206-6173228 AGTTTCTGTGATCAGGAATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169502355 Original CRISPR TTAGCTACTTCAAGTTTGGG GGG (reversed) Intergenic
No off target data available for this crispr