ID: 1169502361

View in Genome Browser
Species Human (GRCh38)
Location 20:6173206-6173228
Sequence AGTTTCTGTGATCAGGAATC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169502355_1169502361 25 Left 1169502355 20:6173158-6173180 CCCCCCAAACTTGAAGTAGCTAA No data
Right 1169502361 20:6173206-6173228 AGTTTCTGTGATCAGGAATCTGG No data
1169502357_1169502361 23 Left 1169502357 20:6173160-6173182 CCCCAAACTTGAAGTAGCTAAAA No data
Right 1169502361 20:6173206-6173228 AGTTTCTGTGATCAGGAATCTGG No data
1169502356_1169502361 24 Left 1169502356 20:6173159-6173181 CCCCCAAACTTGAAGTAGCTAAA No data
Right 1169502361 20:6173206-6173228 AGTTTCTGTGATCAGGAATCTGG No data
1169502359_1169502361 21 Left 1169502359 20:6173162-6173184 CCAAACTTGAAGTAGCTAAAAAT No data
Right 1169502361 20:6173206-6173228 AGTTTCTGTGATCAGGAATCTGG No data
1169502358_1169502361 22 Left 1169502358 20:6173161-6173183 CCCAAACTTGAAGTAGCTAAAAA No data
Right 1169502361 20:6173206-6173228 AGTTTCTGTGATCAGGAATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169502361 Original CRISPR AGTTTCTGTGATCAGGAATC TGG Intergenic
No off target data available for this crispr