ID: 1169506053

View in Genome Browser
Species Human (GRCh38)
Location 20:6213029-6213051
Sequence CAATGGGTGAGGAGCGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169506043_1169506053 -10 Left 1169506043 20:6213016-6213038 CCCACCCCCAACCCAATGGGTGA No data
Right 1169506053 20:6213029-6213051 CAATGGGTGAGGAGCGAGGAAGG No data
1169506042_1169506053 -9 Left 1169506042 20:6213015-6213037 CCCCACCCCCAACCCAATGGGTG No data
Right 1169506053 20:6213029-6213051 CAATGGGTGAGGAGCGAGGAAGG No data
1169506041_1169506053 -8 Left 1169506041 20:6213014-6213036 CCCCCACCCCCAACCCAATGGGT No data
Right 1169506053 20:6213029-6213051 CAATGGGTGAGGAGCGAGGAAGG No data
1169506038_1169506053 -5 Left 1169506038 20:6213011-6213033 CCTCCCCCACCCCCAACCCAATG No data
Right 1169506053 20:6213029-6213051 CAATGGGTGAGGAGCGAGGAAGG No data
1169506037_1169506053 21 Left 1169506037 20:6212985-6213007 CCAGAGCGGAAGGGCGGGGTCTT No data
Right 1169506053 20:6213029-6213051 CAATGGGTGAGGAGCGAGGAAGG No data
1169506033_1169506053 27 Left 1169506033 20:6212979-6213001 CCGCTGCCAGAGCGGAAGGGCGG No data
Right 1169506053 20:6213029-6213051 CAATGGGTGAGGAGCGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169506053 Original CRISPR CAATGGGTGAGGAGCGAGGA AGG Intergenic
No off target data available for this crispr