ID: 1169512481

View in Genome Browser
Species Human (GRCh38)
Location 20:6279169-6279191
Sequence ACTACAATAGAGTGAAGAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169512481_1169512485 13 Left 1169512481 20:6279169-6279191 CCAATTCTTCACTCTATTGTAGT No data
Right 1169512485 20:6279205-6279227 CCATCCTTGCCATGGTGTCATGG No data
1169512481_1169512486 16 Left 1169512481 20:6279169-6279191 CCAATTCTTCACTCTATTGTAGT No data
Right 1169512486 20:6279208-6279230 TCCTTGCCATGGTGTCATGGTGG No data
1169512481_1169512490 29 Left 1169512481 20:6279169-6279191 CCAATTCTTCACTCTATTGTAGT No data
Right 1169512490 20:6279221-6279243 GTCATGGTGGGCAGAGTAGATGG No data
1169512481_1169512488 17 Left 1169512481 20:6279169-6279191 CCAATTCTTCACTCTATTGTAGT No data
Right 1169512488 20:6279209-6279231 CCTTGCCATGGTGTCATGGTGGG No data
1169512481_1169512482 5 Left 1169512481 20:6279169-6279191 CCAATTCTTCACTCTATTGTAGT No data
Right 1169512482 20:6279197-6279219 TTTACATCCCATCCTTGCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169512481 Original CRISPR ACTACAATAGAGTGAAGAAT TGG (reversed) Intergenic