ID: 1169512486

View in Genome Browser
Species Human (GRCh38)
Location 20:6279208-6279230
Sequence TCCTTGCCATGGTGTCATGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169512480_1169512486 17 Left 1169512480 20:6279168-6279190 CCCAATTCTTCACTCTATTGTAG No data
Right 1169512486 20:6279208-6279230 TCCTTGCCATGGTGTCATGGTGG No data
1169512481_1169512486 16 Left 1169512481 20:6279169-6279191 CCAATTCTTCACTCTATTGTAGT No data
Right 1169512486 20:6279208-6279230 TCCTTGCCATGGTGTCATGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169512486 Original CRISPR TCCTTGCCATGGTGTCATGG TGG Intergenic