ID: 1169512486 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 20:6279208-6279230 |
Sequence | TCCTTGCCATGGTGTCATGG TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1169512480_1169512486 | 17 | Left | 1169512480 | 20:6279168-6279190 | CCCAATTCTTCACTCTATTGTAG | No data | ||
Right | 1169512486 | 20:6279208-6279230 | TCCTTGCCATGGTGTCATGGTGG | No data | ||||
1169512481_1169512486 | 16 | Left | 1169512481 | 20:6279169-6279191 | CCAATTCTTCACTCTATTGTAGT | No data | ||
Right | 1169512486 | 20:6279208-6279230 | TCCTTGCCATGGTGTCATGGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1169512486 | Original CRISPR | TCCTTGCCATGGTGTCATGG TGG | Intergenic | ||