ID: 1169513731

View in Genome Browser
Species Human (GRCh38)
Location 20:6294267-6294289
Sequence CTGGAGACTCAGAAAGGGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169513731_1169513739 14 Left 1169513731 20:6294267-6294289 CCTCCCCCTTTCTGAGTCTCCAG No data
Right 1169513739 20:6294304-6294326 CCTATCAATCTAGGTGACCTTGG No data
1169513731_1169513740 15 Left 1169513731 20:6294267-6294289 CCTCCCCCTTTCTGAGTCTCCAG No data
Right 1169513740 20:6294305-6294327 CTATCAATCTAGGTGACCTTGGG No data
1169513731_1169513737 5 Left 1169513731 20:6294267-6294289 CCTCCCCCTTTCTGAGTCTCCAG No data
Right 1169513737 20:6294295-6294317 ATGACTATTCCTATCAATCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169513731 Original CRISPR CTGGAGACTCAGAAAGGGGG AGG (reversed) Intergenic
No off target data available for this crispr