ID: 1169515059

View in Genome Browser
Species Human (GRCh38)
Location 20:6307503-6307525
Sequence TGCACACTTCTACTATCCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169515059_1169515062 -4 Left 1169515059 20:6307503-6307525 CCAAGGGATAGTAGAAGTGTGCA No data
Right 1169515062 20:6307522-6307544 TGCAAGGCCTCTTTAGGTCTAGG No data
1169515059_1169515061 -10 Left 1169515059 20:6307503-6307525 CCAAGGGATAGTAGAAGTGTGCA No data
Right 1169515061 20:6307516-6307538 GAAGTGTGCAAGGCCTCTTTAGG No data
1169515059_1169515063 1 Left 1169515059 20:6307503-6307525 CCAAGGGATAGTAGAAGTGTGCA No data
Right 1169515063 20:6307527-6307549 GGCCTCTTTAGGTCTAGGTTTGG No data
1169515059_1169515065 24 Left 1169515059 20:6307503-6307525 CCAAGGGATAGTAGAAGTGTGCA No data
Right 1169515065 20:6307550-6307572 AACTGACAAAGTGTAATTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169515059 Original CRISPR TGCACACTTCTACTATCCCT TGG (reversed) Intergenic