ID: 1169515062

View in Genome Browser
Species Human (GRCh38)
Location 20:6307522-6307544
Sequence TGCAAGGCCTCTTTAGGTCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169515059_1169515062 -4 Left 1169515059 20:6307503-6307525 CCAAGGGATAGTAGAAGTGTGCA No data
Right 1169515062 20:6307522-6307544 TGCAAGGCCTCTTTAGGTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169515062 Original CRISPR TGCAAGGCCTCTTTAGGTCT AGG Intergenic