ID: 1169515063

View in Genome Browser
Species Human (GRCh38)
Location 20:6307527-6307549
Sequence GGCCTCTTTAGGTCTAGGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169515059_1169515063 1 Left 1169515059 20:6307503-6307525 CCAAGGGATAGTAGAAGTGTGCA No data
Right 1169515063 20:6307527-6307549 GGCCTCTTTAGGTCTAGGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169515063 Original CRISPR GGCCTCTTTAGGTCTAGGTT TGG Intergenic