ID: 1169515065

View in Genome Browser
Species Human (GRCh38)
Location 20:6307550-6307572
Sequence AACTGACAAAGTGTAATTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169515059_1169515065 24 Left 1169515059 20:6307503-6307525 CCAAGGGATAGTAGAAGTGTGCA No data
Right 1169515065 20:6307550-6307572 AACTGACAAAGTGTAATTTCTGG No data
1169515064_1169515065 -2 Left 1169515064 20:6307529-6307551 CCTCTTTAGGTCTAGGTTTGGAA No data
Right 1169515065 20:6307550-6307572 AACTGACAAAGTGTAATTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169515065 Original CRISPR AACTGACAAAGTGTAATTTC TGG Intergenic