ID: 1169528383 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 20:6455450-6455472 |
| Sequence | TGTGTATTACCTACTACTCA GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1169528383_1169528389 | 30 | Left | 1169528383 | 20:6455450-6455472 | CCCTGAGTAGTAGGTAATACACA | No data | ||
| Right | 1169528389 | 20:6455503-6455525 | CCCATTGATTAAACTTTACTGGG | No data | ||||
| 1169528383_1169528387 | 29 | Left | 1169528383 | 20:6455450-6455472 | CCCTGAGTAGTAGGTAATACACA | No data | ||
| Right | 1169528387 | 20:6455502-6455524 | TCCCATTGATTAAACTTTACTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1169528383 | Original CRISPR | TGTGTATTACCTACTACTCA GGG (reversed) | Intergenic | ||