ID: 1169528383

View in Genome Browser
Species Human (GRCh38)
Location 20:6455450-6455472
Sequence TGTGTATTACCTACTACTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169528383_1169528389 30 Left 1169528383 20:6455450-6455472 CCCTGAGTAGTAGGTAATACACA No data
Right 1169528389 20:6455503-6455525 CCCATTGATTAAACTTTACTGGG No data
1169528383_1169528387 29 Left 1169528383 20:6455450-6455472 CCCTGAGTAGTAGGTAATACACA No data
Right 1169528387 20:6455502-6455524 TCCCATTGATTAAACTTTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169528383 Original CRISPR TGTGTATTACCTACTACTCA GGG (reversed) Intergenic